ID: 1106552108

View in Genome Browser
Species Human (GRCh38)
Location 13:30780974-30780996
Sequence CTGTGGCTGTGTTGGGAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106552100_1106552108 10 Left 1106552100 13:30780941-30780963 CCCACCAGATCTCATATTGAAAT No data
Right 1106552108 13:30780974-30780996 CTGTGGCTGTGTTGGGAGTTGGG No data
1106552101_1106552108 9 Left 1106552101 13:30780942-30780964 CCACCAGATCTCATATTGAAATT No data
Right 1106552108 13:30780974-30780996 CTGTGGCTGTGTTGGGAGTTGGG No data
1106552099_1106552108 11 Left 1106552099 13:30780940-30780962 CCCCACCAGATCTCATATTGAAA No data
Right 1106552108 13:30780974-30780996 CTGTGGCTGTGTTGGGAGTTGGG No data
1106552102_1106552108 6 Left 1106552102 13:30780945-30780967 CCAGATCTCATATTGAAATTTGA No data
Right 1106552108 13:30780974-30780996 CTGTGGCTGTGTTGGGAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106552108 Original CRISPR CTGTGGCTGTGTTGGGAGTT GGG Intergenic
No off target data available for this crispr