ID: 1106552135

View in Genome Browser
Species Human (GRCh38)
Location 13:30781124-30781146
Sequence GGGTGGGTTGTTACAAAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106552126_1106552135 22 Left 1106552126 13:30781079-30781101 CCACTCTTGGATTAGTTCTCTTG No data
Right 1106552135 13:30781124-30781146 GGGTGGGTTGTTACAAAGTGAGG No data
1106552125_1106552135 23 Left 1106552125 13:30781078-30781100 CCCACTCTTGGATTAGTTCTCTT No data
Right 1106552135 13:30781124-30781146 GGGTGGGTTGTTACAAAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106552135 Original CRISPR GGGTGGGTTGTTACAAAGTG AGG Intergenic
No off target data available for this crispr