ID: 1106552454

View in Genome Browser
Species Human (GRCh38)
Location 13:30783970-30783992
Sequence CCTCTTTGTGTGTCAGGCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106552449_1106552454 -1 Left 1106552449 13:30783948-30783970 CCAGAAACCAGCTTGGATGCGTC No data
Right 1106552454 13:30783970-30783992 CCTCTTTGTGTGTCAGGCTTGGG No data
1106552448_1106552454 0 Left 1106552448 13:30783947-30783969 CCCAGAAACCAGCTTGGATGCGT No data
Right 1106552454 13:30783970-30783992 CCTCTTTGTGTGTCAGGCTTGGG No data
1106552450_1106552454 -8 Left 1106552450 13:30783955-30783977 CCAGCTTGGATGCGTCCTCTTTG No data
Right 1106552454 13:30783970-30783992 CCTCTTTGTGTGTCAGGCTTGGG No data
1106552447_1106552454 3 Left 1106552447 13:30783944-30783966 CCTCCCAGAAACCAGCTTGGATG No data
Right 1106552454 13:30783970-30783992 CCTCTTTGTGTGTCAGGCTTGGG No data
1106552444_1106552454 21 Left 1106552444 13:30783926-30783948 CCAAATGCCTCACATGGACCTCC No data
Right 1106552454 13:30783970-30783992 CCTCTTTGTGTGTCAGGCTTGGG No data
1106552445_1106552454 14 Left 1106552445 13:30783933-30783955 CCTCACATGGACCTCCCAGAAAC No data
Right 1106552454 13:30783970-30783992 CCTCTTTGTGTGTCAGGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106552454 Original CRISPR CCTCTTTGTGTGTCAGGCTT GGG Intergenic