ID: 1106558511

View in Genome Browser
Species Human (GRCh38)
Location 13:30829996-30830018
Sequence ACAGCCGGAGTCCCGGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106558511_1106558517 6 Left 1106558511 13:30829996-30830018 CCTGGCTCCGGGACTCCGGCTGT No data
Right 1106558517 13:30830025-30830047 CTTGTGCTGGGAGCAGCCCAGGG No data
1106558511_1106558520 20 Left 1106558511 13:30829996-30830018 CCTGGCTCCGGGACTCCGGCTGT No data
Right 1106558520 13:30830039-30830061 AGCCCAGGGGAAGTGTGGCTTGG No data
1106558511_1106558514 -7 Left 1106558511 13:30829996-30830018 CCTGGCTCCGGGACTCCGGCTGT No data
Right 1106558514 13:30830012-30830034 CGGCTGTGCTCATCTTGTGCTGG No data
1106558511_1106558519 15 Left 1106558511 13:30829996-30830018 CCTGGCTCCGGGACTCCGGCTGT No data
Right 1106558519 13:30830034-30830056 GGAGCAGCCCAGGGGAAGTGTGG No data
1106558511_1106558518 7 Left 1106558511 13:30829996-30830018 CCTGGCTCCGGGACTCCGGCTGT No data
Right 1106558518 13:30830026-30830048 TTGTGCTGGGAGCAGCCCAGGGG No data
1106558511_1106558516 5 Left 1106558511 13:30829996-30830018 CCTGGCTCCGGGACTCCGGCTGT No data
Right 1106558516 13:30830024-30830046 TCTTGTGCTGGGAGCAGCCCAGG No data
1106558511_1106558515 -6 Left 1106558511 13:30829996-30830018 CCTGGCTCCGGGACTCCGGCTGT No data
Right 1106558515 13:30830013-30830035 GGCTGTGCTCATCTTGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106558511 Original CRISPR ACAGCCGGAGTCCCGGAGCC AGG (reversed) Intergenic
No off target data available for this crispr