ID: 1106564006

View in Genome Browser
Species Human (GRCh38)
Location 13:30870203-30870225
Sequence TGCTATGTGAGGTCATCTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106564003_1106564006 -5 Left 1106564003 13:30870185-30870207 CCTTCAGTCTGTGACGCATGCTA No data
Right 1106564006 13:30870203-30870225 TGCTATGTGAGGTCATCTAAGGG No data
1106564002_1106564006 25 Left 1106564002 13:30870155-30870177 CCTCTGGAATGGAGAGGATGCTA No data
Right 1106564006 13:30870203-30870225 TGCTATGTGAGGTCATCTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106564006 Original CRISPR TGCTATGTGAGGTCATCTAA GGG Intergenic
No off target data available for this crispr