ID: 1106569509

View in Genome Browser
Species Human (GRCh38)
Location 13:30914428-30914450
Sequence AACTGGCATGCACTGTGATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 141}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106569509 Original CRISPR AACTGGCATGCACTGTGATG AGG Intronic
902926860 1:19701644-19701666 ACCTGGCATGCAAGATGATGCGG - Intronic
904200831 1:28818106-28818128 ACCTGGCATGCCCTGCGCTGTGG + Intronic
908312800 1:62902334-62902356 AACTGGAAAGAACTGTGATGTGG - Intergenic
911282838 1:95952785-95952807 AAATTGCATTCAATGTGATGTGG + Intergenic
911833415 1:102583935-102583957 AAATAGCAAGCACTGTGAGGGGG - Intergenic
915743753 1:158140434-158140456 AATTGGGAAGCGCTGTGATGAGG + Intergenic
917479055 1:175394886-175394908 CACATGCATGCACAGTGATGAGG - Intronic
918202314 1:182279028-182279050 AATTGCCATTCACTGAGATGAGG + Intergenic
920849564 1:209619378-209619400 AAGTGCCAGGCACTGTGCTGGGG - Intronic
922567665 1:226611425-226611447 AACCGGCCTGCACAGTGAGGTGG - Intergenic
922569600 1:226626162-226626184 ACATGGCATGCAGTGTGAAGAGG - Intergenic
1065123194 10:22547630-22547652 AACTGAAATGCCCTGTGAGGGGG + Intronic
1068574519 10:58670241-58670263 AATTGGTATGCACGCTGATGAGG - Intronic
1072685093 10:97531932-97531954 AACTGGCCTGTGGTGTGATGAGG + Intronic
1072710490 10:97713282-97713304 AACTGGCATCCACTGTCACCTGG - Intronic
1076608997 10:131708728-131708750 AACTGGCTTGCACTGGGAGCTGG + Intergenic
1080589227 11:33707106-33707128 GACTGACATTCATTGTGATGAGG - Intronic
1081581729 11:44356726-44356748 AACTGACTTGCTCTGTGCTGAGG + Intergenic
1085049726 11:73374060-73374082 AACTGGGACGAGCTGTGATGGGG - Intergenic
1085481218 11:76824399-76824421 ATCTGTCATGCACTGAGAGGGGG - Intergenic
1087316442 11:96608863-96608885 AAATGCCATGCACTGAAATGGGG - Intergenic
1089197510 11:116703273-116703295 AAATGACATGCACAGTGATGTGG + Intergenic
1091216708 11:133906767-133906789 CCCTGGGATGCACTGGGATGTGG - Intergenic
1091327720 11:134703753-134703775 AGTTTTCATGCACTGTGATGGGG + Intergenic
1091338420 11:134791889-134791911 CACAGCCATGCACTGTGACGTGG - Intergenic
1091753810 12:3038959-3038981 GACTGGCCTGCACGGTGAGGAGG - Intronic
1094553458 12:31474180-31474202 CACAGGCATGCAGTGTGGTGTGG + Intronic
1095419088 12:42006507-42006529 AAATTTCATGCACTGTAATGTGG - Intergenic
1096419076 12:51440795-51440817 AACTGCCATGCTGTGTGATCAGG + Intronic
1101284134 12:103292102-103292124 CACTGGCATGCAATATGATATGG + Intronic
1101310550 12:103574954-103574976 TACTGGCATGGACTGTGGGGAGG + Intergenic
1101606978 12:106254557-106254579 AACTGGCATGTGCTGGGATGTGG - Intronic
1102762582 12:115401354-115401376 CTCTGGCAGGCACTGTGCTGGGG - Intergenic
1103100584 12:118171087-118171109 TGCTGGCATTCACTGAGATGAGG - Intronic
1105356307 13:19663192-19663214 CACTGCCAGGCACTGTGCTGGGG + Intronic
1106569509 13:30914428-30914450 AACTGGCATGCACTGTGATGAGG + Intronic
1106777740 13:33024962-33024984 ATCTGGCATGGGCTGTGAGGGGG + Intronic
1109786966 13:67189413-67189435 AACTAGCAAGCACTGAAATGTGG + Intronic
1112833013 13:103477033-103477055 AACTGAAATGCCCTGTGAGGAGG - Intergenic
1117245731 14:53884644-53884666 ACCTGGCATGTACTGTGGTAAGG + Intergenic
1119141394 14:72270418-72270440 AACTGGCAAAGACTCTGATGTGG + Intronic
1121035987 14:90704027-90704049 GCCAGGCATGCACTGAGATGGGG + Intronic
1121049559 14:90811564-90811586 CACGGGCATCCACAGTGATGTGG - Intronic
1123054167 14:105561375-105561397 AACACACATGCACTGTGGTGAGG - Intergenic
1123078750 14:105681792-105681814 AACACACATGCACTGTGGTGAGG - Intergenic
1124647693 15:31450526-31450548 AATTGGCTTGCACTGTTTTGGGG + Intergenic
1127403187 15:58612691-58612713 TACTGCCATGCACTGTGCTCTGG + Intronic
1127709110 15:61578076-61578098 AAGTGGCATGCACTATTATTTGG + Intergenic
1129252514 15:74316630-74316652 CACTGGCTGGCACTGAGATGTGG - Intronic
1129648330 15:77459604-77459626 AACTGGCATGCAGTTTTCTGGGG + Intronic
1129767493 15:78179444-78179466 AACTGGCATGCAAAGAGAAGGGG + Intronic
1134430274 16:14197734-14197756 ATCTAGCGTGCAGTGTGATGGGG + Intronic
1138669632 16:58602947-58602969 AACTAGCATCAACTGAGATGGGG - Intronic
1139283399 16:65788885-65788907 CACTGGCAGGCACTTGGATGAGG + Intergenic
1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG + Intronic
1144874416 17:18390037-18390059 CAGTGGCATGCAGTGAGATGAGG - Intergenic
1146712986 17:35058796-35058818 AAAGGGCATGCAATGTGATTGGG - Intronic
1147634882 17:41957722-41957744 AGCTGGAATGCAAGGTGATGGGG - Intronic
1150305045 17:64077610-64077632 AAGCGGCATGCACGGTGATGAGG - Intronic
1154166040 18:12015233-12015255 AACTGGCAGGGAATGAGATGGGG - Intronic
1155149102 18:23108700-23108722 AATTGGCATGCTCTGTGACCTGG - Intergenic
1158063312 18:53374459-53374481 AACTGGCATGCTGGGTGATTAGG + Intronic
1162153783 19:8663398-8663420 AACTGCCATGAACTGAGGTGGGG + Intergenic
1162153802 19:8663456-8663478 AACTGCCATGAACTGAGATGGGG + Intergenic
1162153820 19:8663514-8663536 AACTGCCATGAACTGAGATGGGG + Intergenic
1164244480 19:23418482-23418504 AACTGGCATGTGCTGGGTTGTGG - Intergenic
1167028742 19:46942153-46942175 AAATGGCAAGAACTGTGAAGAGG + Intronic
928226267 2:29450851-29450873 AACAGGAATGCACTATGATTAGG - Intronic
930206721 2:48594304-48594326 ACCTGGCATGCCCTGTGAATAGG - Intronic
930825143 2:55689371-55689393 AAGTGGTATTCACTGTGATTTGG - Intronic
931223277 2:60307439-60307461 AACTGGCAAGGGCTGGGATGGGG + Intergenic
935301818 2:101698963-101698985 AACTGGCAAGCACTGAGTGGAGG - Intronic
935723065 2:105996815-105996837 AACTGTCATTCTCGGTGATGGGG - Intergenic
938197977 2:129348399-129348421 TACTGGAATTCACTGAGATGTGG - Intergenic
938624681 2:133095332-133095354 AGCTGGTTTGCACAGTGATGGGG - Intronic
939954441 2:148514749-148514771 AGGTGGCATGCTCTGTGCTGTGG - Intronic
943526634 2:189024762-189024784 TGCTGGCATGTACTGAGATGGGG - Intergenic
944439363 2:199726936-199726958 AGATGGGATGCACTGTGCTGGGG + Intergenic
947038534 2:225888007-225888029 AACTGCCATACAGTGTGATTGGG - Intergenic
1171310375 20:24140456-24140478 CAATGGCATGCACTGGGATTTGG - Intergenic
1175691156 20:61067008-61067030 AACTGGAATGCACTGTGGCTCGG - Intergenic
1177260696 21:18725642-18725664 AAATGGCATGCACGGTGCTAGGG - Intergenic
1179158410 21:38872272-38872294 TACAGGCATGCACTGTGGTGTGG + Intergenic
1179882149 21:44297344-44297366 AACTGCCATGAACTGCCATGGGG + Intronic
1180899248 22:19358900-19358922 ATCTGGCATGGGCTGGGATGGGG + Intronic
1184271784 22:43388588-43388610 AACACGAATGCACTGGGATGGGG - Intergenic
949313145 3:2722715-2722737 AAGTGGCATGCACACTGATTTGG - Intronic
951736320 3:25868997-25869019 AACATGCATGCTCTGTGTTGGGG + Intronic
952385674 3:32839907-32839929 AACTGGGAAGCACTTTGCTGAGG + Intronic
953154175 3:40353878-40353900 AGCTGTCATCCACTGAGATGGGG - Intergenic
955475430 3:59331303-59331325 AACTGACATGTACAGTAATGTGG - Intergenic
955772542 3:62400461-62400483 AAATGATATGCAGTGTGATGAGG - Intronic
961635503 3:128330354-128330376 ATGTGGCAGGCACTGTGCTGAGG + Intronic
962121472 3:132565186-132565208 CCCTGGCAAGCACTGTAATGAGG + Intronic
962209911 3:133468930-133468952 AACTGCCAGGCACTGTGCTAAGG - Intronic
964799997 3:160545923-160545945 AACTGCCATTTACTGAGATGGGG + Intronic
971581087 4:28341948-28341970 GAATGGCATGCACTGTGGTCAGG - Intergenic
971768661 4:30867703-30867725 AACAGACATGCAGTGTGATGTGG + Intronic
982984216 4:162184858-162184880 AACTGAGATGCACTGGGAAGTGG + Intergenic
983783241 4:171699410-171699432 AACTGTCATGAATTGTGATTGGG - Intergenic
984203463 4:176756583-176756605 AACGGGCATGGCATGTGATGGGG + Intronic
988164526 5:27568172-27568194 CACTGGCATGTACTATGTTGGGG - Intergenic
990799862 5:59588292-59588314 AAATGGCATCAACAGTGATGGGG - Intronic
991117604 5:62972091-62972113 TAATGGCATTCACAGTGATGTGG + Intergenic
992000266 5:72429509-72429531 ACATGGCAGGCACTGTGTTGGGG - Intergenic
993849003 5:92982695-92982717 TAGTGACATGCACTGAGATGGGG - Intergenic
994219027 5:97173504-97173526 AAATGTTATGCACTGTGCTGGGG + Intronic
995371272 5:111421464-111421486 TACTGGCATTCACGGTGTTGGGG - Intronic
996887412 5:128374051-128374073 AACTGAAATGCACTGTGTTTAGG + Intronic
999061527 5:148640553-148640575 CACTGGCATTCCCTGTGTTGTGG - Intronic
1005249392 6:23927398-23927420 CACTGGCATGCATTTTCATGTGG - Intergenic
1008030788 6:46690955-46690977 AAATGGCATGCACTCTGAAAGGG - Exonic
1009058482 6:58368038-58368060 AACAGGCAAGCCTTGTGATGTGG - Intergenic
1009232353 6:61079084-61079106 AACAGGCAAGCCTTGTGATGTGG + Intergenic
1009540427 6:64949462-64949484 AACTGGCATGCTGTGAGAGGAGG - Intronic
1018849195 6:167575608-167575630 AACTAGGATGCACTGAGACGGGG + Intergenic
1019229049 6:170542408-170542430 AACTGAGATGTTCTGTGATGTGG + Intronic
1021605566 7:22406081-22406103 TACAGGCATGCACAGAGATGGGG + Intergenic
1026667826 7:72359014-72359036 AAAAAGGATGCACTGTGATGAGG - Intronic
1027786457 7:82585195-82585217 AACTGACATTAAATGTGATGGGG + Intergenic
1028329687 7:89574438-89574460 AATTGACATTCTCTGTGATGTGG - Intergenic
1030169382 7:106586212-106586234 AACTGGCATGCACAGTGTCTAGG + Intergenic
1030626987 7:111855118-111855140 ATCTTCCATGCCCTGTGATGTGG - Intronic
1033575582 7:142680772-142680794 AATTGCCAAGCACTGGGATGGGG + Intergenic
1036397052 8:8378510-8378532 TTCAGGCATGCACTGTGATTGGG - Intronic
1036526323 8:9538291-9538313 CACTGGGCTGCACTGGGATGGGG - Intergenic
1037514707 8:19619001-19619023 AACTGTCAGGCTCTATGATGGGG + Intronic
1037883087 8:22582288-22582310 AACTGCCCTGCCCTGTGGTGTGG + Intronic
1039139755 8:34373348-34373370 AAATGGCATCCACTGTCTTGTGG - Intergenic
1044401816 8:91781559-91781581 AACTGGCAGATACTTTGATGTGG - Intergenic
1047212914 8:122854203-122854225 AAAAGGTCTGCACTGTGATGTGG + Intronic
1048507342 8:135033531-135033553 AAATAGGATGCACTGGGATGGGG + Intergenic
1049328184 8:142034912-142034934 CACTGGACTGCACTGTGCTGGGG - Intergenic
1049445143 8:142626671-142626693 AAGTGGCAAGCACTGTGGTGTGG - Intergenic
1050144149 9:2547851-2547873 TACTGGCATGTACTGTGTAGAGG - Intergenic
1050365849 9:4873203-4873225 AGCTGGCATGCACCCAGATGTGG - Intronic
1052889196 9:33681623-33681645 AATTGCCAAGCACTGGGATGTGG + Intergenic
1053450736 9:38192202-38192224 AACTGGCATGAGCAGTGAGGTGG + Intergenic
1056779785 9:89540783-89540805 AACTGGCTTGCACAATTATGGGG + Intergenic
1057612405 9:96557156-96557178 AACTGTGATGCACTGTGAGCAGG + Intronic
1057735779 9:97658426-97658448 CACTGGCTTGCACTGAGGTGCGG - Intronic
1059217217 9:112575231-112575253 ACCTGGTATGCACTGTGCTGTGG - Exonic
1060787601 9:126463006-126463028 AACTGACATGCGCTTTGATCTGG - Intronic
1061925993 9:133806314-133806336 CCCTGGCATGCACAGAGATGTGG - Intronic
1061936760 9:133862146-133862168 AACCGGCCTGCCCCGTGATGTGG + Intronic
1186765975 X:12771095-12771117 AACTGGCATGCAATGTGGTCTGG - Intergenic
1186967456 X:14803392-14803414 CACAGGCATGTACTGTGCTGGGG + Intergenic
1188019538 X:25142479-25142501 AACTGGCCTGCACCTTGATCTGG - Intergenic
1195283163 X:103356921-103356943 GACTTGCATGCACTGTGGAGAGG + Intronic
1198639844 X:138744483-138744505 AAATGCCACGCACTGTGCTGAGG - Intronic
1199162148 X:144626131-144626153 AATTGGAATGCACCTTGATGTGG + Intergenic
1200383562 X:155865554-155865576 CACTGGCAGTCACTGTGCTGCGG - Intergenic
1202045467 Y:20733460-20733482 CACTGGCATGCACTGGGACCAGG - Intergenic