ID: 1106573619

View in Genome Browser
Species Human (GRCh38)
Location 13:30954001-30954023
Sequence CTGTTTACTCAGCTGGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1242
Summary {0: 1, 1: 0, 2: 4, 3: 103, 4: 1134}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106573619 Original CRISPR CTGTTTACTCAGCTGGAACA TGG Intronic
900110293 1:1002386-1002408 CTGTTTTCTCATCTGTAAAAGGG + Intergenic
900709706 1:4105817-4105839 CTGTTTCCTCAGCTGGCAAGTGG + Intergenic
900961121 1:5921013-5921035 CTGTTTCCTCAGCTGTAAAATGG - Intronic
901068409 1:6505588-6505610 CTGTTTCCTCATCTGTAAAATGG + Intronic
901529498 1:9844250-9844272 CTGTTTCCTAATCTGGAACGTGG - Intergenic
901760913 1:11470863-11470885 CTGTTTCCTCACCTGTAAAATGG - Intergenic
901806473 1:11741691-11741713 CAGTTTTCTCAGCTGTAAAATGG + Intronic
901837768 1:11935211-11935233 CAGTTTGCCCAGCTGGAAAACGG - Intronic
901857197 1:12052243-12052265 CTGCTTACTCAGCACCAACAGGG - Intergenic
901862084 1:12080996-12081018 CAGTTTCCTCATCTGTAACATGG + Intronic
902141609 1:14361438-14361460 CTGTTCACTCCTCTGGAAGAGGG - Intergenic
902185940 1:14725590-14725612 CTGTTTCCTCACCTGTAAAAGGG - Intronic
902272990 1:15318025-15318047 CAGTTTTCTCAGCTGTAAGAAGG - Intronic
902392624 1:16115280-16115302 CTGTTTACTCGTCTGTAAAATGG - Intergenic
902503014 1:16922935-16922957 CTGTTTCCTCATCTGTAAAATGG - Intronic
902564706 1:17303774-17303796 CGGTTTCCTCACCTGGAAAACGG + Intergenic
902607589 1:17577368-17577390 CAGTTTACTCATCTGCAAAATGG - Intronic
902699495 1:18161919-18161941 CTGTTTTCTCATCTGCAAAAGGG + Intronic
902702930 1:18184932-18184954 CTGTTTTCTCACCTGGAAAATGG + Intronic
902718021 1:18286006-18286028 CTGTTTCCTCATCTGCAAAACGG - Intronic
902812001 1:18893249-18893271 CAGTTTCCTCACCTGGAAAATGG + Intronic
902815208 1:18912740-18912762 CTGTTTCCTCACCTGCAAAATGG - Intronic
902929446 1:19720397-19720419 CTGTTTGCTCAGCTGGTAAGTGG + Intronic
902932803 1:19743221-19743243 CAGTTTCCTCATCTGGAAAAGGG + Intronic
902955334 1:19921345-19921367 CTGTTTCCTCACCTAGAAAACGG - Intronic
902981466 1:20126495-20126517 CTGTTTTCTCATCTGTTACACGG + Intergenic
903060458 1:20665105-20665127 CAGTTTCCTCATCTGCAACATGG + Intronic
903345476 1:22681567-22681589 CTGTTTCCTCCCCTGGAAAATGG - Intergenic
903358033 1:22760086-22760108 CAGTTTTCTCAGCTGTAAAATGG - Intronic
903359560 1:22768268-22768290 CAGTTTCCTCATCTGTAACATGG + Intronic
903360362 1:22773188-22773210 CTGTTTCCTCATCTGTAAAATGG - Intronic
903361123 1:22777950-22777972 CAGTTTCCTCACCTGGAAAATGG - Intronic
903391703 1:22968754-22968776 CTGTTTCCTCACCTGTAAAATGG + Intergenic
903497993 1:23784020-23784042 CTGTTTCCTCATCTGTAAAATGG - Intronic
903655300 1:24945558-24945580 CAGTTTCCTCATCTGGAAAATGG - Intronic
903675326 1:25061156-25061178 CAGTTTCCTCATCTGGAAAATGG + Intergenic
903738658 1:25545410-25545432 CGGTTTCCTCATCTGCAACATGG + Intronic
903805634 1:26003792-26003814 CTGTTTTCTCATCTGAAAAATGG - Intergenic
903882683 1:26522298-26522320 CAGTTTTCTCATCTGGAAAATGG + Intergenic
903889041 1:26557554-26557576 CCGTGTACTTATCTGGAACAAGG + Intronic
904131556 1:28279411-28279433 CTGTTTACTCACCTGTAAAATGG + Intronic
904270167 1:29344605-29344627 CTGTTTTCTCATCTGTAAAATGG - Intergenic
904280277 1:29413980-29414002 CTCTTTCCTCATCTGTAACATGG - Intergenic
904303183 1:29569298-29569320 CTGTTTTCTCAGCTTCATCAGGG + Intergenic
904356455 1:29943215-29943237 CAGTTTTCTCAGCTGTAAAATGG - Intergenic
904473594 1:30750759-30750781 CTGTTTCCTCATCTGTAAAATGG + Intronic
904474855 1:30758104-30758126 CTGTTTCCTCATCTGGAAATGGG - Intergenic
904489201 1:30847828-30847850 CAGTTTCCTCATCTGGAAAATGG - Intergenic
904503098 1:30928958-30928980 CTCTTTCCTCAGCTGTAAAATGG - Intergenic
904534064 1:31187691-31187713 CAGTTTCCTCATCTGGAAAATGG + Intronic
904592070 1:31620455-31620477 CAGTTTCCTCATCTGTAACAGGG + Intronic
904607298 1:31704734-31704756 CCGTTTTCTCATCTGGAAGATGG + Intergenic
904624091 1:31792507-31792529 CTGTTTCCTCCTCTGGAAGATGG - Intronic
905011838 1:34752597-34752619 CAGTTTTCCCATCTGGAACATGG + Intronic
905205858 1:36342551-36342573 CTGTTTCCTCTTCTGTAACATGG + Intronic
905270918 1:36786902-36786924 CAGTTTCCTCATCTGGAAAATGG - Intergenic
905329304 1:37181167-37181189 CAGTTTGCTCAGCTGTAAAATGG + Intergenic
905500303 1:38431162-38431184 CTGTTTTCTCATCTGTAAAATGG - Intergenic
905502901 1:38453545-38453567 CTGTTTTCTCATCTGTAAAATGG - Intergenic
905787452 1:40769637-40769659 CAGTTTACTCATCTGTAAAATGG - Intronic
905805768 1:40876306-40876328 CTGTTTCCTCATCTGTAAAATGG + Intergenic
905905975 1:41618745-41618767 CAGTTTCCTCATCTGGAAAATGG - Intronic
906106311 1:43295018-43295040 CTGTTTCCTCATCTGCAAAATGG + Intergenic
906172371 1:43737950-43737972 CAGTTTGCTCAACTGGAAAATGG - Intronic
906196921 1:43935378-43935400 TTGTTTGCTCATCTGGAAAAAGG + Intronic
906257482 1:44361361-44361383 CTGTTTCCTCAACTGTAAAATGG + Intergenic
906533722 1:46539607-46539629 TGGTTTACTCAGCTGCAATAGGG + Intergenic
906689636 1:47784119-47784141 CTGTTTCCTCATCTGGAAACTGG - Intronic
906709265 1:47916986-47917008 CTGTTTTCTCATCTGCAAGACGG - Intronic
906798176 1:48713921-48713943 CAGTTTCCTCAGCTGTAAAATGG - Intronic
906818805 1:48907290-48907312 CTGTTTTCTCATCTAGAAGATGG + Intronic
907078509 1:51599922-51599944 CTGTGTCCTCACCTGGAAGAAGG + Intronic
907527218 1:55060884-55060906 CTGTTTACTCATTTGTAAGATGG - Intronic
907561917 1:55399018-55399040 CAGTTTCCTCATCTGGAAAATGG - Intergenic
907562063 1:55400012-55400034 CTGTTTTCTCACCTGTAAAATGG + Intergenic
907667151 1:56443304-56443326 CGGTTTCCTCATCTGGAAAAGGG + Intergenic
907750460 1:57258236-57258258 CAGTTTCCTCTGCTGTAACATGG - Intronic
907754596 1:57299267-57299289 CAGTTTACTCATCTGTAAAATGG + Intronic
907860096 1:58344758-58344780 CTGTTTTCTCATTTGTAACAGGG + Intronic
908044359 1:60152515-60152537 CGGTTTTCTCAGCTGCAAAATGG - Intergenic
908139932 1:61173806-61173828 CTGGTTACGCAGCTGGAAATGGG - Intronic
908403772 1:63794359-63794381 CGGGTTCCTCACCTGGAACATGG - Intronic
908407899 1:63832580-63832602 CTGTTTCCTTTTCTGGAACATGG + Intronic
908489060 1:64624722-64624744 CTGTTTCCTCAGCTGTCACTTGG + Intronic
908555537 1:65253917-65253939 CAGTTTCCTCATCTGGAAAATGG + Intronic
909504544 1:76373297-76373319 CTGTTTTCTCATCTGTAAGATGG + Intronic
910415346 1:86991710-86991732 CTGTTTTCTCATCTGCAAAATGG + Intronic
910865821 1:91787343-91787365 CTGTTTCCTCATCTGTAAAATGG - Intronic
911069174 1:93818571-93818593 CTGTTTCCTCACCTGTAAAATGG + Intronic
911156328 1:94641268-94641290 CAGTTTACTCATCTGTAAAATGG - Intergenic
911530680 1:99039692-99039714 CTGTTCACTCACCTGGAAAGCGG + Intergenic
911587981 1:99713195-99713217 CAGTTTACTCACCTGTAAAATGG - Intronic
912196750 1:107406480-107406502 CTGTTTCCTCATCTGAAAAAGGG - Intronic
912239917 1:107895479-107895501 CTGTTTCCTCATCTGTAAAATGG - Intronic
912391754 1:109307636-109307658 CTGTTTCCTCATCTGTAAAATGG + Intergenic
912622338 1:111175206-111175228 CTGTTTCCTCATCTGTAAAATGG - Intronic
912792796 1:112669330-112669352 CTGTTTTCTCATCTGCAAAATGG + Intronic
913021473 1:114792325-114792347 CTGTTCACTCACCTGGAAAGAGG - Intergenic
913520453 1:119640590-119640612 CTGTTTGCACAGCTGAATCAAGG - Intronic
913569800 1:120109316-120109338 CTGTTTACTCATCTGCAAAATGG + Intergenic
914256927 1:145967895-145967917 CTGTTTCCTCATCTGTAAAATGG - Intronic
914290609 1:146270282-146270304 CTGTTTACTCATCTGCAAAATGG + Intergenic
914551653 1:148721065-148721087 CTGTTTACTCATCTGCAAAATGG + Intergenic
914804721 1:150983627-150983649 CAGTTTCCTCATCTGGAAAATGG - Intronic
915596311 1:156898272-156898294 CTGTTTACTCATCAGGAAATGGG - Intronic
916731015 1:167566913-167566935 CAGTTTCCTCAGCTGTAAGATGG - Intergenic
917482650 1:175425307-175425329 CTGTTTTCTCATCTGTAACATGG + Intronic
917655447 1:177121321-177121343 CTGTTTGCTCAGCAGCAAAATGG + Intronic
918072098 1:181140670-181140692 CAGTGTTCTCAGCTGGAAGATGG + Intergenic
918139484 1:181708417-181708439 CAGTTTTCTGAGCTGGAAAATGG + Intronic
918256758 1:182755490-182755512 CAGTTTACTCATCTGTAAGATGG + Intergenic
918550060 1:185732823-185732845 GTGTTTACTCAGCTGTAAATGGG - Intergenic
918846827 1:189626365-189626387 CTGTTTACTCACCTCTAAAATGG - Intergenic
919146800 1:193645387-193645409 CTGTTCACTCCCCTGGAAAAGGG - Intergenic
920341212 1:205276268-205276290 CAGTTTCCCCAGCTGAAACATGG + Intergenic
920437926 1:205960225-205960247 CTGTTTCCTCATCTGTAACATGG + Intergenic
920495525 1:206452195-206452217 CTGTCTCCTCATCTGTAACATGG - Intronic
920547626 1:206831705-206831727 CTGTTTACTCATCTGTAAAATGG - Intronic
920735037 1:208526057-208526079 CTGTTTCCTCATCTGTAAAATGG + Intergenic
920914337 1:210247945-210247967 CAGTTTACTCATCTGTAAAATGG + Intergenic
920949763 1:210561455-210561477 CTGTTTCCTCATCTGGAAAATGG + Intronic
921162677 1:212484207-212484229 CTGTTTACAAAGATGGGACAGGG - Intergenic
921294680 1:213690721-213690743 CAGTTTTCTCAGCTGGGAAATGG + Intergenic
921788958 1:219267671-219267693 CTGTTTTCTCATCTGTAAAATGG - Intergenic
922017917 1:221670927-221670949 CTGTTTCCTCACCTGTAAAATGG - Intergenic
922212246 1:223495288-223495310 CAGTTTACTCACCTGCAAAATGG - Intergenic
922324165 1:224512954-224512976 CTGTTTACCCATCTGCAACGTGG + Intronic
922468999 1:225864029-225864051 CAGTTTACTCATCTGTAAAATGG - Intronic
922765751 1:228155793-228155815 CCGTTTCCTCAGCTGAATCAAGG + Intronic
922778140 1:228226959-228226981 CAGTTTCCTCATCTGTAACATGG + Intronic
924462698 1:244273453-244273475 CTGTTTTCTCATCTGTAAAATGG + Intergenic
924829035 1:247573159-247573181 CTGTTTACTCCCCTGGAAAAGGG - Intronic
924861127 1:247923605-247923627 CTATTTTCTCAGCTGGTACATGG + Intergenic
1063043094 10:2363066-2363088 CAGTTTTCTCAGCTGTAAAATGG - Intergenic
1063070326 10:2656041-2656063 CAGTTTCCTCACCTGTAACATGG + Intergenic
1063454305 10:6172514-6172536 CGGTTTCCTCATTTGGAACATGG - Intronic
1063654821 10:7977726-7977748 CTTTTTGCTCAGATGGCACATGG + Intronic
1064202282 10:13294971-13294993 CTGTTTCCTCATCTGTAAAATGG - Intronic
1064284946 10:13984029-13984051 CTCCTCACTCAGCTGGAACTAGG + Intronic
1065155261 10:22862990-22863012 CTGTTTCCTCATCTGTAAGAGGG - Intergenic
1065379549 10:25076038-25076060 TTGTTTTCTCAGCTGTAAAATGG + Intergenic
1066268026 10:33795247-33795269 CTGTTTCCTCATCTGTAAAATGG + Intergenic
1066485021 10:35834961-35834983 CTGAATCCTCAGCTGGAAAAGGG + Intergenic
1066490111 10:35886176-35886198 CAGTTTTCTCAGCTGGAAACTGG - Intergenic
1067136216 10:43609278-43609300 CTAATTACTCAGTTGGAGCAAGG + Exonic
1067478407 10:46580538-46580560 CAGATTCCTCACCTGGAACATGG - Intronic
1067616331 10:47761249-47761271 CAGATTCCTCACCTGGAACATGG + Intergenic
1068406223 10:56593023-56593045 CTGTTTACTCTGCTTGAAAAAGG + Intergenic
1068777399 10:60883002-60883024 CTGTTTCCTCATCTGTAAAATGG - Intronic
1068793669 10:61054145-61054167 CTGTTTCTTCAGCTGTAAAAAGG - Intergenic
1068807485 10:61214926-61214948 CTGTTTTCTAAGCTGTATCATGG - Intergenic
1068854012 10:61778324-61778346 CTGTTTGCTCATCTGTAAAAGGG + Intergenic
1069587782 10:69620148-69620170 CTGTTTCCTCATCTGTAACATGG - Intergenic
1069704074 10:70446433-70446455 CTGCTTGCTCAGCTGTAAAATGG + Intronic
1069783211 10:70969736-70969758 CTGTTTCCTCATCTGTAAAAGGG + Intergenic
1069882800 10:71604092-71604114 CTGTTTTCTCACCTGTAAAATGG + Intronic
1069987785 10:72296066-72296088 CTTTCTACTCAACTGGAACTTGG + Intergenic
1069988025 10:72297535-72297557 CTGTTTCCTCATCTGTAAAATGG + Intergenic
1070110429 10:73481885-73481907 CTTTTTACTCATCTAGAATAAGG + Intronic
1070387994 10:75943359-75943381 CTGTTTTCTCATCTGTAAAATGG - Intronic
1070414580 10:76177850-76177872 CAGTTTTCTCATCTGGAAAATGG - Intronic
1071264427 10:83952022-83952044 CAGTTTCCTCAGCTGTAAAATGG - Intergenic
1071521587 10:86334732-86334754 CGGTTTCCTCCTCTGGAACATGG - Intronic
1071639129 10:87288266-87288288 CTGTTTCCTCAGCTGCAATTGGG - Intergenic
1071656108 10:87449683-87449705 CTGTTTCCTCAGCTGCAATTGGG + Intergenic
1072273108 10:93796512-93796534 CAGTTTACTCATGTGGAAAAAGG + Intronic
1072559081 10:96553423-96553445 CGGTTTTCTCATCTGGAAAATGG + Intronic
1072617840 10:97061243-97061265 CTGTTTTCTCAGCTGTAGAATGG - Intronic
1072620056 10:97073792-97073814 CAGTTTTCTCATCTGCAACATGG + Intronic
1072945668 10:99807943-99807965 CAGTTTTCTCATCTGTAACATGG + Intronic
1073146877 10:101286838-101286860 CTGTTTCCTCAGCTGTAAAATGG - Intergenic
1073477687 10:103765093-103765115 CAGTTTCCTCATCTGGAAAATGG - Intronic
1073487333 10:103827883-103827905 CTGGTTCCTCAGCTGTAAAACGG + Intronic
1074186207 10:111101329-111101351 CAGTTTTCTCAGCTGTAAAATGG + Intergenic
1074269139 10:111935770-111935792 CTCTTTCCTCAGCTTGTACATGG + Intergenic
1074472857 10:113743152-113743174 CTATTTACTCATATGAAACATGG + Intergenic
1074473741 10:113750860-113750882 CTGTTTCCTCATCTGCAAAATGG - Intergenic
1074557918 10:114509013-114509035 CTCTTTGCTCATCTGTAACATGG - Intronic
1074731785 10:116385975-116385997 CTGTTTACTTAGCTGAAAAATGG + Intergenic
1074754756 10:116616042-116616064 CTGTTGTCTCAGCTGTAAAATGG + Intergenic
1074856750 10:117479618-117479640 CTGTTTCCTCATCTGTAAAATGG - Intergenic
1074882007 10:117666877-117666899 CAGTTTTCTCACCTGGAAAATGG + Intergenic
1075197432 10:120372882-120372904 CTGTTTTCTCATCTGTAACATGG - Intergenic
1075256526 10:120929978-120930000 CAGTTTACTCACCTGCAAAATGG + Intergenic
1075284444 10:121171506-121171528 CTGTTTCCTCATCTGTAAGATGG + Intergenic
1075444674 10:122505150-122505172 CAGTTTTCTCATCTGGAAAATGG - Intronic
1075766208 10:124895032-124895054 CTGTTTACTCATCCGTAAAATGG - Intergenic
1076260993 10:129066040-129066062 CTGTTTCCTCATCTGTAAAATGG + Intergenic
1076301448 10:129430579-129430601 CAGTTTCCTCATCTGTAACATGG + Intergenic
1076581645 10:131516162-131516184 CTGTTTTCTCATCTGTAAAAGGG - Intergenic
1077155520 11:1089266-1089288 CTGCATCCTCAGCTGTAACATGG - Intergenic
1077308495 11:1878299-1878321 CTGCCTCCTCAGGTGGAACAAGG + Intronic
1077615263 11:3669531-3669553 CTGTTTCCTCAGCAGGAATATGG + Intronic
1077680334 11:4234163-4234185 CGGTTTGCTCATCTGGAAAATGG - Intergenic
1077681149 11:4241743-4241765 CGGTTTGCTCATCTGGAAAATGG + Intergenic
1077684613 11:4279583-4279605 CGGTTTGCTCATCTGGAAAATGG - Intergenic
1077685429 11:4287186-4287208 CGGTTTGCTCATCTGGAAAATGG + Intergenic
1077690581 11:4338347-4338369 CGGTTTGCTCATCTGGAAAATGG + Intergenic
1077940278 11:6833573-6833595 TTATTAGCTCAGCTGGAACAAGG + Intergenic
1078007380 11:7542197-7542219 CTGTTTTCTCATCTGTAACAGGG + Intronic
1078359465 11:10657235-10657257 CTGTTTCCTCATCTGTAACATGG - Intronic
1078423777 11:11233311-11233333 CTGTTTCCTCATCTGGAAAATGG - Intergenic
1078543446 11:12229393-12229415 CCATTTACTCAGTGGGAACATGG - Intronic
1078655376 11:13234036-13234058 CTGTTTCCTCATCTGTAAAATGG + Intergenic
1078728432 11:13953991-13954013 CAGTTTACTCATCTGCAAAATGG + Intergenic
1078923545 11:15853738-15853760 CTGTTTTCTCATCTGTAAAAGGG - Intergenic
1079032361 11:16995129-16995151 CTGTTTCCTCATCTGAAAAATGG - Intronic
1079244041 11:18740413-18740435 CAGTTTCCTCATCTGGAAAATGG - Intronic
1079322146 11:19460061-19460083 CAGTTTTCTCATCTGGAAAATGG + Intronic
1079323612 11:19472973-19472995 CTGTCTTCTCATCTGGAAAATGG - Intronic
1079329464 11:19521736-19521758 CTGCTTCCTCATCTGGAAAATGG - Intronic
1079331567 11:19537383-19537405 CAGTTTCCTCAGCTGTAAAATGG - Intronic
1079405838 11:20144891-20144913 CTGTTTACTCATCTGTAAAATGG + Intergenic
1080305512 11:30830720-30830742 CTGTTTTCTCATCTGAAAAATGG - Intronic
1080344787 11:31312333-31312355 TGGTTTACTCATCTGGAAAAGGG - Intronic
1080394110 11:31874205-31874227 CAGTTTCCTCACCTGGAAAATGG - Intronic
1080648932 11:34207659-34207681 CAGTTTTCTCAGCTGTAAGATGG - Intronic
1080696472 11:34606954-34606976 CTGTTTCCTCATCTGTAAAATGG + Intergenic
1080717830 11:34821100-34821122 CTGTTTTCTCACCTTGAAAATGG - Intergenic
1080829555 11:35878650-35878672 CAGTTTCCTCAGCTGTAAAAAGG - Intergenic
1080931109 11:36812120-36812142 CTGTTTCCTCAGTTGTAAAATGG - Intergenic
1081140027 11:39487204-39487226 CTGTTTACTCATCTATAAAATGG - Intergenic
1081307846 11:41535265-41535287 CTGTTTTCTCATCTGTAAAATGG + Intergenic
1081444329 11:43115782-43115804 CTGTTTTCTCATCTGTAAGAAGG + Intergenic
1081546140 11:44073285-44073307 CAGTTTCCTCACCTGCAACATGG + Intronic
1081589342 11:44410132-44410154 CTGTTTCCTCATCTGTAAAATGG + Intergenic
1081690451 11:45074329-45074351 CTGTTTCCTCATCTTAAACATGG - Intergenic
1081715998 11:45250981-45251003 CTGTTTCCTCATCTGTAAGAGGG + Intronic
1081780274 11:45705747-45705769 CTGTTTCCTCATCTGGAAAATGG + Intergenic
1081976198 11:47236575-47236597 CTGTTTCCTCATCTGCAAAAAGG + Intronic
1082002289 11:47399992-47400014 CAGTTATCTCAGCTGGAAAATGG - Intergenic
1082738961 11:56889305-56889327 GTGTTTTCTCACCTGGAAAATGG + Intergenic
1082810289 11:57475456-57475478 CTGTTTCCTCATCTGTAAAATGG - Intronic
1083222174 11:61259548-61259570 CTGTTTCCTCATCTGTAAAATGG + Intronic
1083541097 11:63511946-63511968 CTGTTTCCTCATCTGTAAAATGG - Intronic
1083553598 11:63608889-63608911 CAGTTTCCTCAGCTGCAAAATGG + Intronic
1083584926 11:63849843-63849865 CTGTTTGCTCATCTGTAAAATGG + Intronic
1083639383 11:64137038-64137060 CGCTTTTCTCAGCAGGAACAAGG + Intronic
1084101563 11:66952971-66952993 CTGTTTCCTCATCTGTAAAATGG + Intronic
1084102204 11:66957258-66957280 CTGTTTTCTCAGCTGGAGAACGG + Intronic
1084219197 11:67667238-67667260 CAGTTTCCTCATCTGCAACATGG + Intronic
1084375142 11:68771845-68771867 CTGTTTCCTCACCTGTAAAATGG + Intronic
1084386668 11:68847253-68847275 CAGTTTCCTCATCTGTAACATGG + Intergenic
1084434837 11:69132608-69132630 CCGTTTACTCATCTGTAAAATGG + Intergenic
1084459840 11:69290552-69290574 CAGTTTACTCATCTGTAAAATGG + Intergenic
1084520379 11:69659047-69659069 CGGTTTACTCATCTACAACAGGG - Intronic
1084676936 11:70640785-70640807 CAGTTTACTCATCTGTAAAACGG + Intronic
1084888952 11:72227264-72227286 CTGTTTCCTCAGCTGGAGAATGG + Intronic
1084955854 11:72691183-72691205 CTGTTTTCTCACCTGGAAGTGGG + Intronic
1084965521 11:72742397-72742419 CTGTTTCCTAATCTGTAACATGG - Intronic
1085024879 11:73230558-73230580 CTGTTTCCTCAGCTGTAAAATGG - Intronic
1085185504 11:74572682-74572704 CAGTTTCCTCATCTGGAAAATGG - Intronic
1085252259 11:75151596-75151618 CGATTTACTCAGCTGGAGCCAGG + Intronic
1085283901 11:75347718-75347740 CTGTTTCCTCATCTGCAAAATGG + Intronic
1085439138 11:76541999-76542021 CTGTTTCCTCATCTGCAAAATGG - Intronic
1085472445 11:76766953-76766975 CAGTTTTCTCAGCTATAACATGG + Intergenic
1085517787 11:77121590-77121612 CTGCTTCCTCAGCTGTGACATGG + Intronic
1085779557 11:79395930-79395952 CAGTTTACTCATCTGTAAAATGG + Intronic
1086269743 11:85047592-85047614 CTGTTTTCTCATCTGCAAGATGG + Intronic
1086456964 11:86968416-86968438 CTGTTTCCTCATCTGCAAAATGG - Intergenic
1086595262 11:88563211-88563233 CTGTTTTCTCAACTGTAAAATGG - Intronic
1086860768 11:91922425-91922447 CTGTTTCCTTAGCTGTAAAATGG + Intergenic
1086921199 11:92589139-92589161 CTTTTTTATTAGCTGGAACATGG - Intronic
1087585744 11:100119215-100119237 CTGTATTCTCAGCTGGAAACAGG + Intronic
1087716880 11:101618621-101618643 CTGTTTTCTCATCTGTAAGATGG - Intronic
1088008039 11:104965982-104966004 CTGATTACTCAGGTGGGAGATGG - Intronic
1088015496 11:105053914-105053936 CTGTTTTCTCATCTGCAAAATGG - Intronic
1088909681 11:114181332-114181354 CTGTTGCCTCAGCTGTAAAATGG - Intronic
1089259252 11:117211850-117211872 CTGTTTCCTCATCTGTAAAATGG + Intronic
1089775982 11:120836288-120836310 CAGTTTCCTCAGCTGTAAAATGG + Intronic
1089788684 11:120926495-120926517 CAGTTTCCTCATCTGGAAAATGG - Intronic
1089846596 11:121463631-121463653 TTGTTTCCTCATCTGGAAAATGG + Intronic
1089983448 11:122791334-122791356 CTGTTTGCTCATCTAGAAAATGG + Intronic
1090078283 11:123593293-123593315 CTGTGTATTCAGCTGGCTCATGG + Intronic
1090218526 11:124994176-124994198 CTGTTTGGTCAGCTGAAAGACGG + Intronic
1090641637 11:128734335-128734357 CTGAGTACTCAGATGGAAGAAGG + Intronic
1090733410 11:129590931-129590953 CAGTTTTCTCAGCTGTAAAATGG - Intergenic
1091113754 11:132994935-132994957 CAGTTTTCTCAGCTGACACATGG - Intronic
1091157714 11:133388961-133388983 CAGTTTCCTCATCTGCAACATGG - Intronic
1091461184 12:644418-644440 CTGTTTCCTCATCTGTAAAATGG - Intronic
1091615287 12:2046436-2046458 CTGTTTGCTCATCTGCAAAATGG - Intronic
1091696144 12:2629556-2629578 CTGTTTCCACACCTAGAACATGG - Intronic
1091896427 12:4108909-4108931 CTGTTTCCTCATCTGTAAAAAGG - Intergenic
1092168487 12:6358117-6358139 CAGTTTCCTCAGCTGTAAAATGG + Intronic
1092183096 12:6459531-6459553 CAGTTTACTCACCTGTAAAATGG - Intronic
1092949250 12:13485909-13485931 CTGTTTCCTCATCTGAAAAATGG + Intergenic
1093051093 12:14505923-14505945 CTGTTTCCTCATCTGTAAAATGG - Intronic
1093312870 12:17612194-17612216 CTCTTTACTCATCTGCAAAATGG + Intergenic
1093428158 12:19052683-19052705 CTGGTTACTCAGATAGCACATGG + Intergenic
1093837586 12:23854498-23854520 CTGTTTCCTCATCTAGAAAATGG + Intronic
1094156609 12:27344098-27344120 CAGTTTCCTCATCTGAAACATGG - Intronic
1094325014 12:29228334-29228356 CTGTTTTTTCATCTGGAAAATGG + Intronic
1096016873 12:48284402-48284424 CTGTTTTCTCATCTGCAAAATGG + Intergenic
1096110167 12:49024005-49024027 CAGTTTTCTCAGCTGTAAAATGG + Intronic
1096426351 12:51507045-51507067 CAGTTTACTCAGCAGGAAAATGG + Intronic
1096464614 12:51841382-51841404 CAGTTTCCTCACCTGCAACATGG - Intergenic
1096470561 12:51872778-51872800 CTGTTTTCTCATCTGTAAGATGG + Intergenic
1096719302 12:53509159-53509181 CAGTTTCCTCACCTGAAACATGG + Intronic
1096755163 12:53793379-53793401 CTTTTTAAGCAGATGGAACAGGG + Intergenic
1097263014 12:57730225-57730247 CAGTTTCCTCATCTGTAACATGG - Intronic
1098228702 12:68351112-68351134 CAGTTTCCTCATCTGCAACATGG + Intergenic
1098704389 12:73668849-73668871 CTGTTTACTCATTTGTAAAATGG + Intergenic
1098818317 12:75196597-75196619 CTTTTTTCTCATCTGGACCAGGG - Intronic
1099076883 12:78120745-78120767 CTGTTTTCTCATCTGCAAAATGG + Intronic
1099247971 12:80216679-80216701 CTATTTACTCATCTGTAAAAGGG - Intronic
1099943975 12:89222988-89223010 CTGTTCACTCTGCTGGAAAGAGG - Intergenic
1100479429 12:94963753-94963775 CAGTTTCCTCATCTGTAACACGG - Intronic
1100620429 12:96266051-96266073 CTGTTTTCTCATCTGTAAAATGG + Intronic
1100850702 12:98707742-98707764 CTGTTTCCTCATCTGCAAAAGGG - Intronic
1101043653 12:100782654-100782676 CAGTTTCCTTATCTGGAACATGG + Intronic
1101217421 12:102597917-102597939 TAGTTTCCTCAGCTGGAAAATGG - Intergenic
1101263789 12:103063591-103063613 CTGTTGCCTCAGGTGGCACAGGG - Intergenic
1101585538 12:106082450-106082472 CTGTTTCCTCAGCTGTAAAACGG - Intronic
1101875621 12:108595049-108595071 CTGTTTCCTCATCTGTAAAATGG - Intronic
1101913795 12:108880419-108880441 CAGTTTCTTCACCTGGAACATGG + Intronic
1102182614 12:110923764-110923786 CTGTTTCCTCACCTGGAAAAGGG + Intergenic
1102183530 12:110931083-110931105 CAGTTTCCTCATCTGGAAAATGG - Intergenic
1102234590 12:111286317-111286339 CTGTTTCCTCATCTGTAAAATGG - Intronic
1102251832 12:111392740-111392762 CAGTTTCCTCATCTGGAAAATGG + Intergenic
1102253292 12:111402016-111402038 CAGTTTCCTCATCTGGAAAATGG - Intergenic
1102393682 12:112569957-112569979 CTGTTTCCTCATCTGGGAAAGGG - Intergenic
1102421154 12:112803894-112803916 CAGTTTACTCACCTGTAAGATGG + Intronic
1102455208 12:113066610-113066632 CTGTTTCCTCACCTGTAATATGG + Intronic
1102462467 12:113108387-113108409 CAGTTTTCTCACCTGGAAAATGG + Intronic
1102551767 12:113696523-113696545 CTGTTTCCTCATCTGTAAAATGG + Intergenic
1102558283 12:113743308-113743330 CTGTTTCCTCACCTGTAAAATGG + Intergenic
1102591017 12:113956847-113956869 CTGTTTCCTCATCTGTAAAATGG + Intronic
1102642538 12:114379637-114379659 CTGTTTCCTCATCTGTAAAAAGG - Intronic
1102806607 12:115786917-115786939 CAGTTTCCTCATCTGGAAAATGG - Intergenic
1103037149 12:117665769-117665791 CTGTTTCCTCATCTGTAAAATGG - Intronic
1103051442 12:117783415-117783437 CTGTTTCCTCATCTGTAAAATGG + Intronic
1103174096 12:118846875-118846897 CAGTTTCCTCAGCTGTAAAATGG - Intergenic
1103239659 12:119402542-119402564 CTGTTTTCTCATCTGTAAAATGG + Intronic
1103383145 12:120510641-120510663 CTGTTTCCTCATCTGTAAAATGG + Intronic
1103586722 12:121961675-121961697 CTGTTTTCTCATCTGTAAAATGG + Intronic
1103883420 12:124183822-124183844 CTGTTTCCTCATCTTGAAAATGG - Intronic
1103931295 12:124452466-124452488 CGGTTTCCTCATCTGGAATATGG + Intronic
1103982396 12:124745087-124745109 CAGTTTACTCAGCTGTAAAATGG - Intergenic
1104296764 12:127522863-127522885 CTGTTTACTCAACTGTAAAATGG - Intergenic
1104388213 12:128369443-128369465 CAGTTTTCTCAGCTGTAAAATGG - Intronic
1104433985 12:128741080-128741102 CAGTTTGCTCAGCTGTAAAATGG + Intergenic
1104601350 12:130156007-130156029 CTGTTTCCTCTGCTGTAAAATGG - Intergenic
1105451115 13:20501269-20501291 CTGTTTCCTCATCTGGGATATGG - Intronic
1105743124 13:23349758-23349780 CTGTTTCCTCATCAGTAACATGG - Intronic
1105896863 13:24723908-24723930 CTGTTTCCTCATCTGCAAAATGG - Intergenic
1106122992 13:26877348-26877370 CTGTTTTCTCATCTGTAAAATGG + Intergenic
1106217117 13:27712720-27712742 CAGTTTTCTCATCTGGAATATGG + Intergenic
1106323123 13:28660608-28660630 TTGTTTACTCATCTGCACCAAGG - Intronic
1106368166 13:29104279-29104301 CAGTTTGCTCAGCTGTAAAATGG - Intronic
1106573619 13:30954001-30954023 CTGTTTACTCAGCTGGAACATGG + Intronic
1106803649 13:33283404-33283426 CTGTTTTCTCATCTGTAAAATGG + Intronic
1107024727 13:35788275-35788297 CTCTCTGCTCAGCTGGACCACGG - Exonic
1107078735 13:36351089-36351111 CTGTTTTCTCATCTGTAATATGG + Intronic
1107098340 13:36560682-36560704 CAGGTTACTCCGCTGGAACATGG + Intergenic
1107205145 13:37776119-37776141 GTGTTTAGTCAGCTGGCAAATGG - Intronic
1107590124 13:41895134-41895156 CTGTTTACTGAGTGGGAACATGG + Intronic
1108236809 13:48416587-48416609 CTGTTAACTCCCCTGGAACAGGG + Intronic
1108313074 13:49214885-49214907 CTTTTTACACAGCAGGGACACGG - Intergenic
1108738538 13:53310622-53310644 CTGTTTTCTCATCTGTAAAACGG + Intergenic
1108932065 13:55837502-55837524 CTGTTTCCTCATCTGGAAATGGG + Intergenic
1109236629 13:59829484-59829506 CTGTTTCCTCATCTGAAAAATGG + Intronic
1109293715 13:60505091-60505113 CTGTTCACTCTGCTGGAAAGGGG + Intronic
1110391191 13:74976202-74976224 CAGTTTCCTCATCTGGAAAATGG + Intergenic
1110542565 13:76722460-76722482 CTGTTTCCTCAGTTGAAACAAGG + Intergenic
1111627927 13:90813345-90813367 CCGTTTACTCCCCTGGAAAAGGG + Intergenic
1112262758 13:97892425-97892447 CTGTTTTCTCATCTGTAAAATGG - Intergenic
1112350995 13:98632949-98632971 CTGTTTTCTCAACTGCAAAATGG - Intergenic
1112928150 13:104702846-104702868 CTGATTGCTCATCTGGAAAATGG - Intergenic
1113599638 13:111559578-111559600 CTGTTTTCTCATCTGTAAAATGG - Intergenic
1113969537 13:114177822-114177844 CTGGTTCCTCAGCTGGGACTCGG - Intergenic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1114415425 14:22539753-22539775 CTGTTTCCTCACCTGTAAAATGG - Intergenic
1114526738 14:23371240-23371262 CAGTTTCCTCATCTGTAACATGG + Intergenic
1114814353 14:25939060-25939082 TGGGTTACTCAGTTGGAACATGG + Intergenic
1115182108 14:30641043-30641065 CTGTTTTCTCATCTTGAAAATGG - Intronic
1116663979 14:47751082-47751104 CTGGTTACTCATCTGGTTCATGG - Intergenic
1116967859 14:51032710-51032732 CAGTTTCCTCATCTGCAACATGG + Intronic
1117155813 14:52939605-52939627 CTGGTTCCTCATCTGGAAAATGG - Intronic
1117736367 14:58772993-58773015 CTGTTTCCCCACCTGTAACATGG + Intergenic
1117777102 14:59194010-59194032 CAGTTTCCTCATCTAGAACATGG - Intronic
1118386636 14:65261124-65261146 CAGTTTCCTCATCTGGAAAATGG + Intergenic
1118572849 14:67211115-67211137 CTGTTTCCTCATTTGTAACATGG + Intronic
1118753138 14:68820908-68820930 CTGTTTCCTCATCTGTAAGATGG - Intergenic
1118860480 14:69659106-69659128 CTGTTTCCTCAGCTGCAGAATGG + Intronic
1118864662 14:69693446-69693468 CTTATTACTGAACTGGAACAAGG + Intronic
1119010053 14:70976236-70976258 CTGTTTCCTCATCTGCAAAATGG - Intronic
1119280461 14:73402705-73402727 CTGTTTCCTCATCTGTAAAATGG - Intronic
1119406108 14:74400804-74400826 GTGTTTTCTCATCTGGAAAACGG - Intergenic
1119613806 14:76085121-76085143 CTGTTTCCTCATCTGTAAAATGG - Intergenic
1119614141 14:76087320-76087342 CTGTTTTCTAATCTGGAAAATGG + Intergenic
1119920785 14:78444242-78444264 CTGTTTCCTCATCTGTAAAATGG - Intronic
1120640287 14:87002578-87002600 ATGTTTACTAAGATGGAACGTGG - Intergenic
1120646232 14:87077853-87077875 CTGTTTCCTCATCTGTAAAATGG - Intergenic
1121235102 14:92386325-92386347 CAGTTTTCTCAGCTGTAAAATGG + Intronic
1121442757 14:93959117-93959139 CTGTTTCCTCATCTGCAAAATGG - Intronic
1121455699 14:94037760-94037782 CAGTTTCCTCAGCTGTAAAATGG - Intronic
1121612055 14:95288018-95288040 CTGTTTTCTCTGCTGCAAAATGG - Intronic
1121737557 14:96228948-96228970 CTGCTTTCCCATCTGGAACATGG + Intronic
1121870987 14:97407262-97407284 CGGTTTACTCATCTGTAAAATGG - Intergenic
1121911988 14:97800167-97800189 CTGTTTCCTCATCTGTAAAATGG - Intergenic
1122087175 14:99316185-99316207 CAGTTTCCTCATCTGGATCAGGG - Intergenic
1122163957 14:99807342-99807364 CAGTTTCCTCAGCTCTAACAAGG + Intronic
1122267992 14:100555552-100555574 CTGTTTCCTCATCTGGAAAACGG - Intronic
1122454653 14:101841111-101841133 CAGTTTTCTCAACTGGAAAATGG - Intronic
1122559787 14:102604536-102604558 CTGTTTCCTCATCTGGAAAATGG - Intronic
1122660208 14:103290143-103290165 CTGTTGACTCACCAGGAGCAGGG + Intergenic
1122813853 14:104302600-104302622 CTGTTTGCTCATCTGTAAAATGG + Intergenic
1123434752 15:20247019-20247041 CAGTTTCCTCAGCTGTAAAATGG + Intergenic
1124533201 15:30523639-30523661 CTGTTTCCTCAGCTGAGAAATGG - Intergenic
1124972320 15:34500219-34500241 CTATTTACTCTGCTGTAGCAGGG - Intergenic
1125224873 15:37384489-37384511 CAGTTTACTCATCTGCAAAATGG + Intergenic
1125302944 15:38276567-38276589 CTGTTTGCTCACCTGAAACATGG - Intronic
1125744003 15:41986873-41986895 CTGTTTCCCCATCTGTAACATGG + Intronic
1126067250 15:44835505-44835527 CTGTTTCCTCATCTGTAAAATGG - Intergenic
1126092579 15:45065044-45065066 CTGTTTCCTCATCTGTAAAATGG + Intronic
1126109223 15:45166054-45166076 CTGTTTTCTCATCTGCAAAATGG + Intergenic
1126917244 15:53479446-53479468 CAGTTTACTCAACTGTAAAATGG + Intergenic
1127029999 15:54851186-54851208 CTGTTTACTCCCCTGGAAAGGGG + Intergenic
1127312923 15:57768288-57768310 CTGTTTTCTCAGCTGAAAAGGGG + Intronic
1127360319 15:58239458-58239480 CTGTTTCCTCATCTGTAAAATGG + Intronic
1127395368 15:58540424-58540446 CAGTTTTCTCACCTGGAAAATGG - Intronic
1127497118 15:59523877-59523899 CTGTTTTCTCATCTGTAAAATGG - Intergenic
1127961103 15:63891552-63891574 CTGTTTTCTCATCTGCAAAATGG + Intergenic
1128108952 15:65064310-65064332 CTGTTTCCTCATCTGTAAAATGG - Intronic
1128231984 15:66041812-66041834 CTGTTTTCTCATCTGTAAAATGG - Intronic
1128261013 15:66232861-66232883 CTGTTTCCTCATCTGTAAAATGG - Intronic
1128285827 15:66436261-66436283 TTGTCTCCCCAGCTGGAACAAGG + Intronic
1128297459 15:66536310-66536332 CTGTTTCCTCATCTGTAAAAAGG + Intronic
1128354043 15:66911830-66911852 CGGTTTCCTCAGCTGTAAAATGG + Intergenic
1128767204 15:70258475-70258497 CGGTTTCCTCATCTGTAACATGG + Intergenic
1129110232 15:73332877-73332899 ATGTTTTCTCATCTGGAAAATGG + Intronic
1129461005 15:75700059-75700081 CAGTTTCCTCACCTGTAACATGG - Intronic
1129723816 15:77891666-77891688 CAGTTTCCTCACCTGTAACATGG + Intergenic
1129940583 15:79493681-79493703 CAGTTTACTCATCTGTAAAATGG + Intergenic
1130354734 15:83118990-83119012 CTGTTTCCTCATCTGTAAAATGG + Intronic
1130844268 15:87729814-87729836 CTGTATACTCAGCAGGGCCATGG + Intergenic
1131064279 15:89423612-89423634 CTGGTTCCTCATCTGGAACAGGG - Intergenic
1131121655 15:89826843-89826865 GTGTTTCCTCAGCTGGGAAATGG - Intergenic
1131151336 15:90049230-90049252 CTGTTTTCTCAACTGCAAAATGG - Intronic
1131449869 15:92530402-92530424 CTGCTTCCTCAGCAGGAAGAAGG + Intergenic
1131679971 15:94710915-94710937 CAGTTTTCTCAGCTGGGAAATGG + Intergenic
1132092064 15:98955091-98955113 CTGTTCCCTCATCTGTAACATGG + Intronic
1132239086 15:100243917-100243939 CTGTTTTCTCATCTGGAAAATGG - Intronic
1132313933 15:100877571-100877593 CTGTTTACTCACCCGTAAAATGG + Intergenic
1132709635 16:1260583-1260605 CGGTTTCCTCATCTGGAACCTGG + Intergenic
1133395861 16:5446916-5446938 CCGTTTCCTCATCTGCAACATGG + Intergenic
1133409006 16:5552456-5552478 CAGTTTTCTCACCTGAAACATGG - Intergenic
1133625168 16:7564221-7564243 CTGTGTTCTCAGATGGAAGAGGG - Intronic
1133749844 16:8716138-8716160 CTGTTTTCTCCACTGGAAAATGG - Intronic
1133859206 16:9578114-9578136 CTGTTTTCTCATCTGTAAAATGG + Intergenic
1133865841 16:9642731-9642753 CTGTTTCCTCATCTGTAAGATGG - Intergenic
1134020594 16:10918711-10918733 CTGTTTTCTTACCTGGAAAATGG + Intronic
1134022868 16:10933532-10933554 CAGTTTCCTCATCTGGAAAAGGG + Intronic
1134043558 16:11085486-11085508 CTGTTTCTTCAGCTGTAAAATGG + Intronic
1134113402 16:11530442-11530464 CTGTTTCCTCATCTGTACCATGG - Intergenic
1134183056 16:12062984-12063006 CTGTGTCCTCATCTGGAAAATGG + Intronic
1134390758 16:13817851-13817873 CAGTTTACTCATCTGTAAAACGG + Intergenic
1134638751 16:15812250-15812272 CTGTTTTCCCAGCTGTAAAAGGG + Intronic
1134869737 16:17641009-17641031 CTGTTTTCTCATCTGTAAAATGG + Intergenic
1134891337 16:17844228-17844250 CTGTTTTCTCATCTGTAATATGG + Intergenic
1134892078 16:17850161-17850183 CAGTTTACTCAGCAGCAAAATGG - Intergenic
1134892252 16:17851472-17851494 CTGTTTACCCACCTGGAAATGGG + Intergenic
1135023383 16:18981033-18981055 CTGTTTTCTCATCTGTAAAATGG - Intergenic
1135166360 16:20142664-20142686 CTGTTTTCTCATCTGCAAAATGG + Intergenic
1135266770 16:21033452-21033474 CTGTTTTCCCAGCTGTAAAATGG - Intronic
1135335115 16:21595072-21595094 CTGTTTCCTCATCTGTAAAATGG - Intergenic
1135458734 16:22622631-22622653 CTGTTTCCTCATCTGTAAAATGG - Intergenic
1135575794 16:23584616-23584638 CTGTTTCCTCAGCTGTAAAGTGG - Intronic
1135664168 16:24322018-24322040 CAGTTTCCTCATCTGGTACACGG - Intronic
1136079306 16:27841154-27841176 CTGTGTCCTCAGCTGGAAAATGG - Intronic
1136170781 16:28487935-28487957 CAGTTTCCTCATCTGGAAAATGG + Intronic
1136391610 16:29968839-29968861 CTGTTTCCTCATCTGTAAAATGG - Intronic
1136394359 16:29985044-29985066 CTGTTTCCTCAACTGGATAATGG - Intronic
1136849873 16:33604091-33604113 CAGTTTCCTCAGCTGTAAAATGG - Intergenic
1137382655 16:48013331-48013353 CTGTTTCCTCATCTGTAAAATGG + Intergenic
1137440104 16:48490962-48490984 CAGTTTCCTCAGCTGAAAAATGG - Intergenic
1137491705 16:48938477-48938499 CTGTTTCCTCATCTGGAAAATGG - Intergenic
1137500307 16:49005926-49005948 CAGTTTACTCATCTGTAAAAGGG - Intergenic
1137580709 16:49632035-49632057 CTGTTTACTTGGCTGTAAAATGG + Intronic
1137634086 16:49970401-49970423 CTATTTCCTCACCTGTAACACGG + Intergenic
1137777996 16:51072341-51072363 CTGTTTTCTCATCAGTAACACGG - Intergenic
1137911043 16:52378902-52378924 GTGATGACTCAGCTGGGACAGGG - Intergenic
1137980233 16:53063207-53063229 CTGTTTGCTCAGTAGTAACATGG - Intronic
1138143327 16:54586911-54586933 CTGTTTTCTCATCTGTAAAATGG - Intergenic
1138333373 16:56233104-56233126 CTGTTTTCTCATCTGTAAAATGG + Intronic
1138334695 16:56243926-56243948 CAGTTTCCTCAGCTGCAAAATGG - Intronic
1139192532 16:64881224-64881246 TTGTTTGCACAGCTGGAAAAGGG + Intergenic
1139821051 16:69721610-69721632 CAGTTTTCTCATCTGTAACATGG - Intronic
1139883980 16:70195916-70195938 CTGTTTACTCATCTGAGAAACGG + Intergenic
1140175865 16:72659047-72659069 CAGATTACACAGCTGAAACAAGG - Intergenic
1140190953 16:72816051-72816073 CTTTTTACATAGCTGTAACATGG - Intronic
1140231328 16:73119592-73119614 CTGTTGGCTCACATGGAACATGG - Intergenic
1140368536 16:74399580-74399602 CTGTTTACTCATCTGAGAAACGG - Intergenic
1140624322 16:76773189-76773211 AGATTTACTCAGCTGGAAAAGGG - Intergenic
1140696023 16:77535020-77535042 CTGTTTCCTCATCTGTAAAATGG + Intergenic
1140789643 16:78379068-78379090 CTGTTTTCTCATCTGTAAAATGG + Intronic
1141007403 16:80365161-80365183 CTGTTTCCACATCTGGAAAATGG - Intergenic
1141196992 16:81867490-81867512 CAGTTTCCTCACCTGGAAGATGG + Intronic
1141324213 16:83040160-83040182 CAGGTTCCTCAGCTGGAAAAGGG + Intronic
1141366145 16:83445199-83445221 CAGTTTCCTCAGCTGCAAAATGG - Intronic
1141748233 16:85940544-85940566 CTGCTTCCTCATCTGTAACATGG - Intergenic
1141766351 16:86062357-86062379 CAGTTTCCTCAGCTGCAAAATGG - Intergenic
1141854607 16:86672597-86672619 CTGCTCACACAGCTGGAACCCGG - Intergenic
1141929831 16:87194960-87194982 CTGTTTTCTCATCTGCAAAATGG - Intronic
1142397133 16:89838513-89838535 CTGTTTCATCAGCGGGAACCAGG + Intronic
1203111484 16_KI270728v1_random:1452544-1452566 CAGTTTCCTCAGCTGTAAAATGG - Intergenic
1142682686 17:1559663-1559685 CTGTTTACTAGCCTGGAGCAAGG - Intronic
1143500537 17:7336286-7336308 CAGTTTTCTCATCTGGAAGATGG - Intergenic
1143853067 17:9827383-9827405 CAGTTTACTCATCTGTAAAAGGG - Intronic
1144283255 17:13747912-13747934 CTGTTTGCTCATCCGGATCAAGG + Intergenic
1144629340 17:16862501-16862523 CTGTTTCCTCATCTGGAAAGTGG - Intergenic
1144652087 17:17013615-17013637 CTGTTTCCTCATCTGGAAAGTGG + Intergenic
1144823025 17:18088641-18088663 CTGTGTACTAAGATGGAGCAGGG - Intronic
1144836111 17:18157569-18157591 CTGTTTCCTCATCTGTAAAATGG + Intronic
1144854781 17:18261717-18261739 CTGTTTGCTCACCTGTAAGATGG - Intronic
1145243195 17:21251587-21251609 CAGTTTCCTCATCTGTAACACGG + Intronic
1145879610 17:28343735-28343757 CTGTTCACTCATCTGTCACATGG - Intronic
1145907847 17:28526031-28526053 CAGTTTCCTCATCTGCAACACGG - Intronic
1146056177 17:29582402-29582424 CAGTTTACTCATCTGTAAAATGG - Intronic
1146513749 17:33472957-33472979 CAGTTTTCTCAGCTGTAAAATGG + Intronic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1146645701 17:34576107-34576129 CAGTTTTCTCATCTGGAAAATGG + Exonic
1146799684 17:35808752-35808774 CTGTCTTCTCATCTGCAACATGG + Intronic
1146935534 17:36810501-36810523 CAGTGTCCTCATCTGGAACATGG + Intergenic
1146943990 17:36861951-36861973 CTGTTTCCTCATCTGTAAAATGG + Intergenic
1146947778 17:36885470-36885492 CTGTTTTCTCATCTGTAAAACGG - Intergenic
1146976315 17:37115875-37115897 CAGTTTACTCACCTGCAACTTGG - Intronic
1147308790 17:39581664-39581686 CTGTTTGCTCATCTGAAAAATGG - Intergenic
1147880090 17:43647791-43647813 CTGTTTCCTCTGCTGGAAATCGG - Intronic
1147927558 17:43954921-43954943 CAGTTTCCTCATCTGGAAAATGG - Intronic
1148236338 17:45971729-45971751 CTGTGGAAACAGCTGGAACACGG - Intronic
1148478264 17:47943130-47943152 CTGTTTCCTCACCTGTAAAATGG + Intronic
1148690816 17:49525815-49525837 TTGTTTCCTCAGCTGTAAAATGG + Intergenic
1148780371 17:50117947-50117969 CAGTTTCCTCAGCTGTAAAATGG + Intronic
1149028750 17:52060901-52060923 TTGTTTTCTCATCTGGAAAAAGG + Intronic
1149537109 17:57441495-57441517 CTCTGCACTCAGCTGGAACTGGG + Intronic
1149960372 17:61102968-61102990 CTGTTTTCTCAACTGTAAAATGG - Intronic
1150208025 17:63423831-63423853 CTGCTTTCTCAGCTAGACCAGGG + Exonic
1150551604 17:66215800-66215822 CTGCTTATTCATCTTGAACATGG - Intronic
1150563361 17:66315240-66315262 CTGTTTCCTCATCTGTAAAACGG - Intronic
1151000625 17:70371099-70371121 CTGTTTATTCAATTGGAAAATGG - Intergenic
1151306574 17:73266518-73266540 CTGTTTGCTCATCTGTAAAAGGG - Intergenic
1151340415 17:73467387-73467409 CGGTTTCCTCATCTGTAACATGG + Intronic
1151498765 17:74475382-74475404 CAGTTTACTCATCTGTAAAATGG - Intronic
1151755587 17:76073742-76073764 CAGTTTCCTCAGCTGTAACAAGG - Intronic
1151906361 17:77052044-77052066 CTGTTTCCTCAGCTGTAAAATGG + Intergenic
1152018730 17:77769311-77769333 CTGTTTCCTCATCTGTAAAATGG + Intergenic
1152207488 17:78982022-78982044 CTGTTTTCTCATCTGTAACAGGG - Intergenic
1152636271 17:81431722-81431744 CAGTTTCCTCAGCTGTAAAATGG - Intronic
1153119161 18:1700412-1700434 CTGTTTACTCCTCTGGAAAGAGG + Intergenic
1153588534 18:6648953-6648975 CTGTTTTCTCATCTGTAATATGG - Intergenic
1153609769 18:6871912-6871934 CAGTTTCCTCAGCTGTAAAATGG - Intronic
1153701210 18:7695030-7695052 CTGTTTCCTCATCTGCAAAATGG - Intronic
1154008405 18:10555191-10555213 TTGTTTACTCACCTGAAAAATGG - Intergenic
1154101570 18:11479420-11479442 CTGTTCACTCACCTGGAAAGGGG - Intergenic
1155246474 18:23915077-23915099 CTGTTTCCTCATCTGTAAAATGG - Intronic
1155301788 18:24436166-24436188 CTGTTTTCTCATCTGTAAAAAGG + Intronic
1155624367 18:27817353-27817375 CTGTTTTCTCACCTGTAAAACGG + Intergenic
1156028230 18:32681937-32681959 CAGATTGCTCATCTGGAACATGG + Intronic
1156077668 18:33300622-33300644 CTCTTTGCTCAGGTGTAACATGG - Intronic
1156515090 18:37672475-37672497 CTGTTTTCTCACCTGTAAAATGG + Intergenic
1156858226 18:41807806-41807828 CGGTTTCCTCATCTGTAACATGG - Intergenic
1157207177 18:45710511-45710533 CTGTTTCCTCAGCTTGTAAAAGG + Intergenic
1157410343 18:47457944-47457966 CAGTTTACTCATCTGGAAATCGG + Intergenic
1157654104 18:49368639-49368661 CTCTTTTCTCTGCTGGAACTGGG - Intronic
1158025126 18:52886645-52886667 CTGTTTCCTCTGCTGGGAAAAGG + Intronic
1158320444 18:56256372-56256394 CGATTTTCTCAGCTGGAAAATGG + Intergenic
1158592924 18:58792500-58792522 CTGTGTACTCAGCTGTGAAATGG + Intergenic
1158695472 18:59699348-59699370 CTGTTTTCTCATCTGTAAAATGG + Intergenic
1158828328 18:61250020-61250042 CAGTTTTCTCATCTGTAACATGG + Intergenic
1159112729 18:64078497-64078519 TAGTTTACTCAGCTGTAAAATGG - Intergenic
1160737755 19:671934-671956 CTGTTTTCTTATCTGTAACATGG - Intergenic
1160774420 19:848472-848494 CAGTTTCCTCATCTGGAAAATGG + Intergenic
1161205826 19:3040913-3040935 CCGTTTGCTCATCTGGAAAAGGG + Intronic
1161212170 19:3072746-3072768 CAGTTTCCTCATCTGGAATATGG - Intergenic
1161251497 19:3282763-3282785 CAGTTTGCTCATCTGGAAAATGG + Intronic
1161323115 19:3650283-3650305 CTATTTCCTCAGCTGGAAACAGG + Intronic
1161338402 19:3727127-3727149 CAGTTTCCTCATCTGTAACATGG + Intronic
1161449299 19:4335736-4335758 CTGTTTCCCCAGCTGTAAAATGG + Intronic
1161630663 19:5353668-5353690 CAGTTTGCTCAGCTGCAAAAAGG - Intergenic
1161644804 19:5446526-5446548 CAGTTTCCTCATCTGGAAAATGG + Intergenic
1161786712 19:6331021-6331043 CTGTTTTATCACCTGGAAAATGG + Intronic
1161815835 19:6499412-6499434 CTGTTTTCTCACCTGTAAAATGG + Intronic
1162146939 19:8618191-8618213 CAGTTTTCTCATCTGGAAAATGG + Intergenic
1162446410 19:10725610-10725632 CAGTTTCCTCATCTGGAAAATGG + Intronic
1162501546 19:11056893-11056915 CTGTTTACCACGCTGGAAAATGG - Intronic
1162763776 19:12905178-12905200 CTGTTTTCTCAGCTATAAAATGG - Intronic
1162791409 19:13064969-13064991 CTGTTTCCTCATCTGTAAAAGGG - Intronic
1162837993 19:13334069-13334091 CCGTTTCCTCAGCTGTTACATGG - Intronic
1162839955 19:13349173-13349195 CCGTTTCCTCATCTGGAAGATGG + Intronic
1162852647 19:13442637-13442659 CAGTTTTCTCACCTGGAAAAAGG - Intronic
1163003023 19:14380943-14380965 CTGTTTCCTCATCTGGAAAATGG + Intronic
1163091622 19:15023897-15023919 CTGTTTCCTCAACTGTAAAATGG - Intergenic
1163153094 19:15426153-15426175 CTGTTTCCTCCGCTGCAAAATGG + Intronic
1163481420 19:17558836-17558858 CAGTTTCCTCATCTGTAACATGG - Intronic
1163597645 19:18229664-18229686 CAGTTTACTCATCTGTAAAATGG - Intronic
1163730058 19:18943750-18943772 CAGTTTTCTCACCTGGAAAATGG + Intergenic
1163831996 19:19551466-19551488 CAGTTTTCTCAGCTGTAAAATGG - Intergenic
1163882400 19:19937165-19937187 CTGATCACTCATCTGGAGCAGGG - Intergenic
1164239655 19:23373792-23373814 CTGATTACTTATCTGGAGCAAGG - Exonic
1164557348 19:29263718-29263740 CTGTTTCCTCATCTGGAAAATGG - Intergenic
1164978999 19:32598626-32598648 CTGTTTCCTCAGGTGTAAAACGG - Intronic
1165030991 19:32998150-32998172 CAGTTTCCTCAGCTGTAAAATGG + Intronic
1165899961 19:39164767-39164789 CTGTTTCCACAGCTGCAAAATGG + Intronic
1165951869 19:39478540-39478562 CTGTTTCCTCAGCTGGCTGATGG - Intergenic
1166091737 19:40513632-40513654 ATGTTTGCTCAGCTGGAACTAGG + Intronic
1166092297 19:40517799-40517821 CAGTTTCCTCATCTGGAAAATGG - Intronic
1166129199 19:40735933-40735955 CAGTTTCCTCATCTGGAAAACGG - Intronic
1166552334 19:43674515-43674537 CAGTTTTCTCAGCTGGAGAAGGG + Intergenic
1166554357 19:43688256-43688278 CAGTTTTCTCATCTGGAAAATGG + Intergenic
1166709956 19:44930521-44930543 CTGTTGCCTAGGCTGGAACACGG + Intergenic
1166729088 19:45048216-45048238 CAGTTTACTCATCTGTAACATGG + Intronic
1166729152 19:45048667-45048689 CAGTTTACTCATCTGTAACATGG + Intronic
1166791800 19:45403089-45403111 CTGTTTCCTCATGTGGACCATGG + Intronic
1167023497 19:46896724-46896746 CTGTTTTCTCATCTGTAAAATGG + Intergenic
1167027516 19:46931842-46931864 CTGTTTTCTCAACTGTAAAATGG + Intronic
1167153362 19:47722891-47722913 CAGTTTCCTCATCTGGAAAATGG + Intronic
1167190132 19:47981666-47981688 CAGTTTACTCTGCTGTAAAATGG + Intronic
1167240752 19:48341953-48341975 CAGTTTTCTCATCTGGAAAATGG - Intronic
1167593890 19:50417687-50417709 CTGTTTGCTCAGCAGGCACGGGG - Intronic
1167632536 19:50634458-50634480 CTGTTTTCTCATCTGTAAAATGG - Intronic
1168345227 19:55647566-55647588 CTGTTAACTCACCTGCAAAATGG - Intronic
925734372 2:6948491-6948513 CAGTTTTCTCAGCTGGATGATGG - Intronic
926088503 2:10035148-10035170 CTGTTTTCTCATCTGTAAAATGG - Intergenic
926104804 2:10143429-10143451 CAGGGCACTCAGCTGGAACAAGG - Intronic
926209736 2:10861191-10861213 CTGTTTTCTCACCTGTAAAATGG - Intergenic
926251127 2:11155930-11155952 CTGTTTTCTCATCTGTAAAATGG - Intronic
927152719 2:20204981-20205003 CTGTTTTCTCATCTGCAAAATGG - Intronic
927633562 2:24794401-24794423 CTGTTTCTTCATCTGGAAAATGG + Intronic
927708581 2:25311778-25311800 GTGTTTGCTCAGCTGGAAAATGG - Intronic
927713029 2:25337470-25337492 CAGTTTCCTCACCTGTAACATGG - Intronic
928220598 2:29399868-29399890 CTGTTTTCTCATCTGTAAAATGG - Intronic
928360222 2:30656521-30656543 CAGTTTCCTCAGCTGGAAAATGG + Intergenic
928513527 2:32023463-32023485 CTGTTTCCTCATCTGCAAAATGG + Intronic
928845465 2:35666525-35666547 CAGTTTCCTCATCTGGAAAATGG - Intergenic
929103972 2:38345838-38345860 CTGTTTTCTCATCTGGAAAATGG + Intronic
929217566 2:39431814-39431836 CAGTTTCCTCAGCTGTAAAATGG - Intronic
929509369 2:42554876-42554898 CCTTTTAATCAGCTGGAAGAAGG - Intronic
929615097 2:43300399-43300421 CTGTTTCCTCATCTGTAAAATGG - Intronic
930027439 2:47037748-47037770 CTGTTTCCTCATCTGTAAAAGGG - Intronic
930053206 2:47232972-47232994 CTGTTTGCTCAACTGCAAAATGG + Intergenic
930056384 2:47255307-47255329 CAGTTTCCTCATCTGGAAAATGG + Intergenic
930244518 2:48969523-48969545 CAGTTTCCTCAGCTGTAAAATGG + Intronic
930607807 2:53510455-53510477 CAGTTTACTCATCTGTAAAATGG - Intergenic
931220292 2:60283303-60283325 TTGTTTCCTCACCTGGAAAATGG + Intergenic
931422467 2:62141058-62141080 TTGATTACTCAAGTGGAACAAGG + Intronic
931443708 2:62309238-62309260 CTGTTTCCTCATCTGCAAAATGG - Intergenic
931444926 2:62318809-62318831 CAGTTTCCTCAGCTGTGACATGG - Intergenic
932136658 2:69237012-69237034 CTGTGTAATCAGATGGAAAAAGG + Intronic
932434107 2:71693071-71693093 CAGTTTTCTCATCTGAAACATGG + Intergenic
932605636 2:73163606-73163628 CTGTTTCCTCATCTGTAAAATGG - Intergenic
932741108 2:74291780-74291802 CTGTTTTCTCAGCTTTAAAACGG - Intronic
932800079 2:74733873-74733895 CTGTTTTCTCATCTGGGAAAGGG + Intergenic
933988956 2:87619850-87619872 CTGTTTCCTCATCTGGAAAATGG - Intergenic
934559016 2:95302652-95302674 CAGTTTACTCATCTGCAAAATGG - Intronic
935069708 2:99683253-99683275 CTGTTTCCTCATCTGTAAAATGG + Intronic
935117175 2:100146738-100146760 CAGTTTCCTCAGCTGTAACATGG + Intergenic
935157028 2:100492549-100492571 CAGTTTACTCATCTGTAAGATGG + Intergenic
935851321 2:107222680-107222702 CTGTTTACTCATCTGAAATTTGG - Intergenic
936304887 2:111330976-111330998 CTGTTTCCTCATCTGGAAAATGG + Intergenic
936411672 2:112263795-112263817 CTGTCTTCACAGCTGCAACAAGG + Intergenic
937000779 2:118465347-118465369 CAGTTTACTCATCTGGAAAATGG + Intergenic
937030316 2:118733431-118733453 CAGTTTCCTCATCTGGAAAATGG + Intergenic
937916349 2:127100932-127100954 CGGTTTCCTCATCTGAAACAGGG - Intronic
938656925 2:133443747-133443769 CTGTTTTCTCTACTGGAAGAGGG + Intronic
938740763 2:134229929-134229951 CTCTTTAGTCAGCAGGAAAATGG + Intronic
938798046 2:134735191-134735213 CAGTTTTCTCAGCTGTAAGATGG - Intergenic
940370535 2:152896028-152896050 CTGTTTACTCCTCTGGAAAGGGG + Intergenic
940663195 2:156573208-156573230 CTGTTTTCTCAGCTATAACATGG - Intronic
941076349 2:161010440-161010462 CTGTTCACTCCCCTGGAAAAGGG + Intergenic
941078970 2:161038224-161038246 CTGTTTCCTCAGTTGTAAAATGG - Intergenic
942338178 2:174914130-174914152 CTGTTTCCTCATCTGTAAAATGG + Intronic
942889549 2:180971620-180971642 ATGTTTACTAAGCTCCAACAGGG + Intronic
943003394 2:182358779-182358801 CAGTTTCCTCATCTGTAACACGG - Intronic
943673832 2:190696950-190696972 CTGTTTTCTCATCTGCAAAATGG - Intergenic
944838138 2:203599832-203599854 CAGTTAACTCATCTGCAACATGG + Intergenic
944951369 2:204753572-204753594 CTGATTACACAGCTGGAACTAGG - Intronic
945045227 2:205776007-205776029 CTGTTTCCTCATCTGTAAAATGG + Intronic
945406851 2:209459232-209459254 CTGTTTTCTCATCTGTAAAATGG + Intronic
946032773 2:216718101-216718123 CAGTTTACTCATCTGGCAAATGG + Intergenic
946145199 2:217725374-217725396 CTGTTTGCTGAGCTGGAAGAGGG - Intronic
946194249 2:218023684-218023706 CCGTTTCCTCATCTGGAAAATGG - Intergenic
946208443 2:218128120-218128142 CAGTTTACTCATCTGTAAAATGG - Intronic
946246828 2:218392676-218392698 CTGTTTTCTCATCTGTAAAATGG - Intronic
946547738 2:220763750-220763772 CAGTTTCCTCATCTGGAAAATGG - Intergenic
946615045 2:221500163-221500185 CTGTTTCCTCACCTGGAGAATGG - Intronic
947681445 2:232037523-232037545 CTGTTCACCCCGCTGGAAAAGGG - Intronic
947682117 2:232044381-232044403 CTGTTTAATAAGCTAGAACATGG + Intronic
947703772 2:232257976-232257998 CTGTTTTCTCAACTGTAAAATGG + Intronic
947731013 2:232431672-232431694 CAGTTTTCTCATCTGTAACATGG + Intergenic
948671879 2:239574176-239574198 CTGTTTTCTCATCTATAACATGG + Intergenic
1168876438 20:1175303-1175325 CTGTTTCCTCATCTGTAAAAGGG - Intronic
1168946905 20:1768423-1768445 CAGTTTACTCATCTAGAAAATGG - Intergenic
1168979870 20:1995263-1995285 CTGTTTTCTCATCTGCAAGATGG - Intergenic
1169231622 20:3893142-3893164 CTGTTTTCTCATCTGGAAATTGG - Intronic
1169264654 20:4160502-4160524 CTGTTTCCTCATCTGTAAAATGG + Intronic
1169537114 20:6556981-6557003 CAGTTTACTCAGCTATAAAATGG + Intergenic
1169608703 20:7353797-7353819 CAGTTTCCTCATCTGGAAAATGG - Intergenic
1170115075 20:12849117-12849139 CAGTTTCCTCACCTGTAACATGG - Intergenic
1170309575 20:14977580-14977602 CAGTTTCCTCAGCTGGAAATTGG + Intronic
1170805439 20:19626260-19626282 CAGATTTCTCAGCTGAAACATGG - Intronic
1170846093 20:19963127-19963149 CGGTTTTCTCATCTGGAAAATGG - Intronic
1171125022 20:22595017-22595039 CAGTTTTCTCATCTGGAAAAGGG + Intergenic
1171970393 20:31561408-31561430 CAGTTTACTCATCTGCAAAATGG - Intronic
1172033002 20:31994934-31994956 CTGTTTCCTCAGCTGTGAAATGG - Intronic
1172196545 20:33095680-33095702 CAGTTTTCTCATCTGGAAAACGG + Intronic
1172196905 20:33098054-33098076 CAGTTTTCTCATCTGTAACATGG + Intronic
1172261295 20:33568138-33568160 CAGTTTTCTCAGCTGTAAAATGG + Intronic
1172272362 20:33661993-33662015 CTGTTTTCTCATCTGCAAAATGG - Intronic
1172335913 20:34115200-34115222 CAGTTTCCTCATCTGGAAAAAGG - Intergenic
1172614601 20:36274961-36274983 CAGTTTACTCATCTGCAAAAGGG + Intergenic
1172803268 20:37593257-37593279 CTGTTTCCTCATCTGCAAGATGG - Intergenic
1172848942 20:37946874-37946896 CTGTTTCCTCAACTGGAATAAGG - Intergenic
1172870359 20:38131906-38131928 CAGTTTATTCATCTGTAACATGG - Intronic
1172871424 20:38137886-38137908 CAGTCTACTCATCTGGAAAACGG + Intronic
1173114989 20:40232866-40232888 CTGTTTTCTCATCTGTAAAATGG - Intergenic
1173143974 20:40509353-40509375 CTGTTTCCTCATCTGTAAAATGG + Intergenic
1173149107 20:40550733-40550755 CTGTTTCCTCATCTGTAAAATGG - Intergenic
1173256903 20:41400218-41400240 CTGTTTCCTCATCTGTAAAATGG - Intergenic
1173464833 20:43272466-43272488 CTGTTTCCTCATCTGCAAAATGG - Intergenic
1173562725 20:44017758-44017780 CTGTTTTCTCATCTGTAAAATGG - Intronic
1173847293 20:46196191-46196213 CTGTTTCCTCATCTGTAAAATGG + Intronic
1173863796 20:46301343-46301365 CTGTTTCCTCATCTAGAAAATGG - Intronic
1174285529 20:49470222-49470244 CTGTTTCCTCATCTGTAAAATGG - Intronic
1174292843 20:49521210-49521232 CGGTTTACTCATCTGTAAAATGG - Intronic
1174435930 20:50506940-50506962 GTATTTATTCAGCTGGAACCTGG + Intergenic
1174483568 20:50847562-50847584 CAGTTTCCTCAGCTGTAAGATGG - Intronic
1174519766 20:51120434-51120456 CTGTTTCCTCATCTGTAAAATGG - Intergenic
1175277855 20:57783989-57784011 CTGTTTTCTCATCTGTAAAAAGG - Intergenic
1175806556 20:61832309-61832331 CAGTTTCCTCATCTGTAACAGGG + Intronic
1178430610 21:32515551-32515573 CTGTTTAGTCATCTGTAAAATGG - Intergenic
1178494687 21:33076766-33076788 CTGTTTTCTCATCTGTAAAATGG - Intergenic
1178537931 21:33425564-33425586 CTGCTCACTTAGCTGGGACAAGG + Intronic
1178640561 21:34342185-34342207 CTGTTTCCTCACCTGCAAAATGG - Intergenic
1178897881 21:36575407-36575429 CTGTTTCCTCATCTGTAAAATGG - Intronic
1179007537 21:37528740-37528762 CTGTTTCCTCATCTGTAAAATGG + Intergenic
1179040173 21:37795873-37795895 CTGTTTCCTCATCTGTAAGATGG - Intronic
1179123242 21:38568419-38568441 CAGTTTCCTCAGCTGTAAAATGG - Intronic
1179524855 21:41969191-41969213 CAGTTTCCTCATCTGTAACATGG + Intergenic
1180865416 22:19116053-19116075 CAGTTTCCTCATTTGGAACATGG - Intronic
1181396547 22:22627102-22627124 CTTTTTACTTTGCTGAAACAGGG - Intergenic
1181783897 22:25211983-25212005 CTGTTGCCTCATCTGTAACATGG + Intergenic
1181791051 22:25266818-25266840 CTGTTTCCTCATCTGTAAAATGG + Intergenic
1181810737 22:25402529-25402551 CAGTTTTCTCAGCTGTAAAATGG - Intronic
1181826863 22:25523848-25523870 CTGTTTCCTCATCTGTAAAATGG + Intergenic
1181900644 22:26152743-26152765 CTGTTTCCTCATTTGGAAAATGG + Intergenic
1181919526 22:26309902-26309924 CTGTTTTCTCATCTGTAAAATGG - Intronic
1181921114 22:26321206-26321228 CAGTTTACTCATCTGGAAAATGG - Intronic
1181922325 22:26330047-26330069 CAGTTTCCTCATCTGGAAAATGG + Intronic
1181927665 22:26373086-26373108 CTGTTTGCTCATCTGTAAAATGG + Intronic
1182028142 22:27136411-27136433 CTGTTTCCTCATCTGAAAAATGG + Intergenic
1182046378 22:27277473-27277495 CAGTTTACTCATCTGTAAAATGG + Intergenic
1182062205 22:27406360-27406382 CAGTTTCCTCATCTGGAATATGG - Intergenic
1182100523 22:27654582-27654604 CTGTTTCCCCATCTGGGACATGG - Intergenic
1182352379 22:29706061-29706083 CAGTTTGCTCAGCTAGAAAACGG + Intergenic
1182712053 22:32329283-32329305 CAGTTTACTCATCTGCTACATGG + Intergenic
1182772777 22:32807592-32807614 CAGTTTCCTCAGCTGTAAAATGG - Intronic
1183100491 22:35580747-35580769 CAGTTTCCTCACCTGGAAAATGG + Intergenic
1183346368 22:37310523-37310545 CTGTTTCCTCATCTGTAAAATGG + Intronic
1183727992 22:39600101-39600123 CTGTTTCCTCATCTGTAAAATGG + Intronic
1183919972 22:41157948-41157970 CTGTTAACTCATCTGGAGTAGGG + Intronic
1184230311 22:43155178-43155200 CAGTTTCCTCATCTGGAAAATGG + Intronic
1184249082 22:43250094-43250116 CTGTTTCCTCAGCTGTAAAATGG - Intronic
1184308720 22:43627414-43627436 CTGTTTTCTCATCTGTAAAATGG + Intronic
1184349895 22:43936656-43936678 CTGATTTCTCAGCTGAAAAATGG + Intronic
1184473486 22:44708643-44708665 CTGTTTGCTCATCTGCAAAATGG - Intronic
1184504822 22:44894375-44894397 CAGTTTTCTCATCTGCAACATGG - Intronic
1184586309 22:45450417-45450439 CTGTTTCCCCAGCTGTAAAATGG + Intergenic
1184608709 22:45589196-45589218 CAGTTTCCTCATCTGGAAAATGG - Intronic
1184691054 22:46117424-46117446 ATGTTCACCCAGCTGGCACAGGG - Intergenic
1184846643 22:47091759-47091781 CAGTTTCCTCAGCTGGAAAAAGG - Intronic
1185263533 22:49884996-49885018 CTTTTTATTCTGCTGGAAGATGG - Exonic
949541047 3:5032256-5032278 CTGTCTGCTCAGCTCTAACATGG - Intergenic
950115292 3:10446874-10446896 CTGTTTTCTCATCTGTAAAATGG - Intronic
950182442 3:10925337-10925359 CTGTTTTCTTAGCTGAAATATGG - Intronic
950189202 3:10964969-10964991 CAGTTTCCTCATCTGTAACATGG + Intergenic
950221075 3:11196575-11196597 CTGTTTACTCACCTAGCACATGG + Intronic
950258180 3:11522966-11522988 CTGTTTTCTCATCTGTAAAATGG + Intronic
950281027 3:11708116-11708138 CTATTTCCTCATCTGGAAAATGG + Intronic
950326824 3:12118453-12118475 CTGTTTCCTCATCTGTAAAATGG - Intronic
950367861 3:12501147-12501169 GTGTCTTCTCACCTGGAACATGG - Intronic
950439493 3:13000889-13000911 CTGTTTTCTCACCTGTAAAATGG - Intronic
950572342 3:13809245-13809267 CAGTTTCCTCAGCTGTAAAATGG + Intergenic
950685572 3:14616321-14616343 CAGTTTACTCATCTGTAAAATGG - Intergenic
950712996 3:14827108-14827130 CTGTTTTCTCACCTGGAAAATGG - Intronic
951526822 3:23661304-23661326 CTGTTTTCTCATCTGTAAAATGG - Intergenic
951685105 3:25335111-25335133 CTGTTTCCTCAGCTATAATATGG + Intronic
952523666 3:34187122-34187144 CTGTTTCCTCACCTGTAAAATGG - Intergenic
952579020 3:34808852-34808874 CTGTTTTCTCATCTGTAACAGGG - Intergenic
952865082 3:37849850-37849872 CTGTTTCCTCATCTGTAAGATGG + Intergenic
952868927 3:37880198-37880220 CTGTTTCCTCAGCTGTAAAAGGG - Intronic
952932423 3:38370640-38370662 CGGTTTCCTCATCTGGAACAAGG + Intronic
953243081 3:41166802-41166824 CTTTTTCCTCATCTGCAACATGG - Intergenic
953453301 3:43021684-43021706 CTGTTTCCTCAGCTATAAAATGG - Intronic
953466187 3:43121784-43121806 TTGTTTCCTCATCTGTAACATGG + Intergenic
953679197 3:45026830-45026852 CTGTTTTCTCAACTGTAAAATGG + Intronic
954304109 3:49716558-49716580 CAGTTTCCTCATCTGGAAAATGG + Intronic
954422535 3:50426209-50426231 CTGTTTTCTCATCTGTAAAACGG + Intronic
954841519 3:53515749-53515771 CTGTTTTCTCACCTGTAAGATGG + Intronic
954921001 3:54190898-54190920 CTGTTTTCTCATCTGTAAAATGG + Intronic
955026814 3:55175570-55175592 CTGTTTTCTCATCTGCAAAAAGG - Intergenic
955027064 3:55178406-55178428 CAGTTTACTAACCTGTAACAGGG - Intergenic
955215156 3:56979293-56979315 CAGTTTACTCAGTTGCAAAATGG - Intronic
955330203 3:58041069-58041091 CAGTTTCCTCAGCTGCAAAACGG - Intronic
955392594 3:58532166-58532188 CTGTTTCCTTAACTGGAAAATGG - Intronic
955715170 3:61821867-61821889 CTGTTTACTCATCTGTAAAATGG - Intronic
955835518 3:63050271-63050293 CTGTTTCCTCATCTGTAAAATGG + Intergenic
955945330 3:64188266-64188288 CAGTTTTCTTAGCTGTAACACGG - Intronic
956036043 3:65093145-65093167 CAGTTTTCTCAGCTGTAAAATGG - Intergenic
956093731 3:65694511-65694533 CAGTTTACTCATCTGAAAAATGG - Intronic
956130514 3:66049086-66049108 CTGTTTCCTCACCTGTAAAATGG - Intergenic
956406789 3:68936310-68936332 CAGTTTTCTCATCTGTAACATGG - Intergenic
956499594 3:69868272-69868294 CAGTTTTCTCAGCTGCAAAATGG - Intronic
956672809 3:71707245-71707267 CAGTTTACTCATCTGTAAGATGG - Intronic
956724733 3:72147586-72147608 CTGTTTGTTCATCTGTAACAGGG + Intergenic
956779038 3:72589931-72589953 CTGTTTACTTATCTGTAATATGG - Intergenic
958012088 3:87892533-87892555 CAGTTTTCTCATCTTGAACAAGG + Intergenic
958050716 3:88341493-88341515 CTGTTTCCTCATCTGTAAGATGG + Intergenic
958067460 3:88562096-88562118 AAATTTACTCAGCTGGAAGATGG + Intergenic
958134464 3:89470521-89470543 CTGTTTCCTCATCTGTAAAATGG - Intronic
958455432 3:94325338-94325360 CTGTTTTCTCACCTGCAAAATGG + Intergenic
959973663 3:112434470-112434492 CAGTTTACTCAACTGAAAGATGG + Intergenic
960333954 3:116393325-116393347 CCGTTTACCCAGCTGGCACCAGG - Intronic
960360673 3:116706914-116706936 CTGTTTCCTCACCTGTAAAATGG - Intronic
960394197 3:117116479-117116501 CTGTTTCCTCATCTGTAAAATGG + Intronic
960964464 3:123095137-123095159 CTGTTTCCTCAGCTGTGAAATGG + Intronic
960996406 3:123343379-123343401 CAGTTTCCTCACCTGTAACATGG - Intronic
961156524 3:124684375-124684397 CTTTTTATTGAGCTGGAAAATGG - Intronic
961433158 3:126897637-126897659 CTGTTTTCTCAGCTATAAAAAGG + Intronic
961438798 3:126938361-126938383 CTGTCTTCTCAGCTGTAAGATGG + Intronic
961573766 3:127818770-127818792 CTGTTTCCTCATCTGTAAAATGG + Intronic
962041837 3:131715542-131715564 CAGTTTCCTCAGCTGTAAAATGG + Intronic
962200770 3:133399700-133399722 CAGTTTACTCATCTGTAAAATGG + Intergenic
962895902 3:139714535-139714557 CTGTTTTCTCATCTGTAAAAAGG + Intergenic
963043738 3:141087611-141087633 CTGTTTGCTCATCTGGAAAATGG - Intronic
963377819 3:144492468-144492490 CAGTTTCCTCAGCTGCAAAATGG - Intergenic
963723614 3:148893017-148893039 CTGTTTACTAAACCTGAACAGGG + Intronic
964634708 3:158846241-158846263 CAGTTTCCTCAGCTGTAAAATGG - Intergenic
965116398 3:164495294-164495316 CAGTTTCCTCAGCTGGAAAATGG + Intergenic
965406248 3:168273223-168273245 CAGTTTCCTCATCTGTAACATGG + Intergenic
965511081 3:169568370-169568392 CTGTTCACTCCCCTGGAAAAGGG + Intronic
965622788 3:170657296-170657318 CAGTTTCCTCAGCTGTCACATGG - Intronic
965697787 3:171427477-171427499 CAGTTTCCTCAGCTGTAAAATGG + Intronic
965787395 3:172350262-172350284 TTGTTTCCTCAGCTGTAAAATGG - Intronic
965927316 3:173997641-173997663 TTGTTTACTCAACTGAAAAATGG - Intronic
966224996 3:177588764-177588786 CTGTTTACTTATCTGTAATATGG + Intergenic
966243694 3:177782315-177782337 CTGTTTTCTCAGCTGCAAAATGG + Intergenic
966429265 3:179814375-179814397 CAGTTTCCTCATCTGTAACATGG - Intronic
966909670 3:184551979-184552001 CTGTCTCCTCACCTGGAAAATGG - Intronic
967415593 3:189214631-189214653 TTTTTTATTCAGCTGGACCAGGG - Intronic
967722314 3:192828489-192828511 CTGTTTTCTCATTTGGAAAATGG + Intronic
967760072 3:193213949-193213971 CTGTTTCCTCACCTGAAAAATGG - Intergenic
967943981 3:194787630-194787652 CTGTTTCCTCACCTGTAAAATGG + Intergenic
967989468 3:195120420-195120442 CAGTTTTCTCATCTGGAAAATGG + Intronic
968237270 3:197040765-197040787 CTGTTTACTTATCTGTAAAATGG - Intergenic
969140816 4:5070052-5070074 CTGTTTATTCAGCCAGAAGAAGG + Intronic
969179977 4:5432902-5432924 CAGTTTACTCATCTGTAAGAAGG - Intronic
969202531 4:5617290-5617312 CTGTTTTCTCATCTGTAAAATGG + Intronic
969362143 4:6671758-6671780 CTGTTTCCTCAGCTTGAAATGGG - Intergenic
969484715 4:7465894-7465916 CTGTTTCCTCATCTGCAAAACGG - Intronic
969552171 4:7877537-7877559 CTGTTTCCTCACCTACAACACGG - Intronic
969834356 4:9827926-9827948 CTGTTTCCTCATTTGCAACATGG + Intronic
970320713 4:14872876-14872898 CAGTTTTCTCAGCTGTAAAAGGG + Intergenic
971163814 4:24161503-24161525 CAGTTTCCTCACCTGGAAAATGG + Intergenic
971300082 4:25434681-25434703 CAGTTTACTCAGCTGTGAAATGG - Intergenic
971305972 4:25482008-25482030 CTGTTTCCTCAGCTGTAAGATGG + Intergenic
971412192 4:26385396-26385418 CTGTTTCCTCATCTGTAAAAAGG - Intronic
971498719 4:27295759-27295781 CAGGTTCCTCAGCTGTAACATGG + Intergenic
972369856 4:38412652-38412674 CTGTTTACTCAGGTGGATGGAGG + Intergenic
972588419 4:40460500-40460522 CAGTTCACTCAACTGGAAAATGG + Intronic
973168396 4:47107579-47107601 CTGTTTATTCATCTGTAAAATGG + Intronic
973743631 4:53942323-53942345 CAGTTTTCTCAGCTGGAATATGG + Intronic
974020036 4:56684979-56685001 CTGTTTCCTCATCTGTAATATGG + Intergenic
974391446 4:61275148-61275170 CTGTTCATACAACTGGAACAAGG + Intronic
975607308 4:76168114-76168136 CTGTTTCCTCATCTGTAAAATGG + Intronic
975627702 4:76365969-76365991 CAGTTTCCTCAGCTGTAAAATGG + Intronic
975661624 4:76694637-76694659 CTGTTTCCTCATCTGCAAGATGG + Intronic
975674580 4:76813274-76813296 CTGTTTGCTCATCTGTAAAATGG + Intergenic
975691813 4:76972899-76972921 CTGTTTTCTCATCTGTAAAATGG - Intronic
976106775 4:81627484-81627506 CTGTGGTCTCAGCTGGAACTTGG - Intronic
976216975 4:82724661-82724683 CTGTTTCCTCATCTGAAAAATGG + Intronic
976328334 4:83798568-83798590 CAGTTTGCTCAGCTGTAAAATGG - Intergenic
976446000 4:85130104-85130126 CTGTTCACTCTGCTGGAAATGGG - Intergenic
976715914 4:88122317-88122339 CTGTTCACTCCCCTGGAAAAGGG + Intronic
977381645 4:96281926-96281948 TTGTTTTCTCAGCTTGAAAAAGG + Intergenic
977644026 4:99391026-99391048 CTGTGTACTCACATGGAAAAAGG + Intergenic
977862180 4:101975554-101975576 CTGTTTCCTCATCTGTAAAATGG + Intronic
978377778 4:108093971-108093993 CTGTTTCCTCATCTGTAAAAGGG - Intronic
978723655 4:111945116-111945138 CTGTTTACTCTCCAGTAACATGG + Intergenic
979203335 4:118005437-118005459 TTGTGTACCTAGCTGGAACAAGG - Intergenic
979305080 4:119133272-119133294 CTGTTTTCTCATCTGTAAAATGG - Intergenic
979417433 4:120460808-120460830 CTGTTTACTCCCCTGGAAAGGGG + Intergenic
979748883 4:124251281-124251303 CTGTATGCTCAGCGGGAACCAGG - Intergenic
980893887 4:138842757-138842779 TAGTTTACTCAGCTGTAAAATGG + Intergenic
981718303 4:147774048-147774070 CAGTTTCCTCAGCTGTAAAATGG + Intronic
983573618 4:169236556-169236578 CTGCTTCCTCACCTGGAAAATGG + Intronic
983859646 4:172689156-172689178 CTCTTTACTAATCTGGAACCAGG + Intronic
984653300 4:182291586-182291608 CTGCTTCCTCAGCTGTACCATGG - Intronic
984779910 4:183515697-183515719 CAGTTTGTTCAGCTGGAAAATGG + Intergenic
986028948 5:3877452-3877474 CTGTCTTCTCACCTGGAGCAAGG - Intergenic
986198668 5:5561287-5561309 CTGATGGCTCAGCTGGAACCAGG + Intergenic
986224647 5:5801456-5801478 GTGTTTTCTCAGCTGGCAGAGGG + Intergenic
987029317 5:13961230-13961252 CAGTTTCCTCATCTGGAAAATGG - Intergenic
987989613 5:25193453-25193475 CTGTTTCCTCAGCTTGCAGATGG + Intergenic
988616624 5:32781271-32781293 CAGTTTCCTCAGCTGTAACATGG + Intronic
988617730 5:32792086-32792108 CTGCTTAGTATGCTGGAACATGG - Intergenic
988704583 5:33712070-33712092 CAGTTTACTCATCTGTAAAATGG + Intronic
988997859 5:36731506-36731528 CAGTTTCCTCATCTGGAAAATGG - Intergenic
989274273 5:39568797-39568819 CTGTTTTCTCACCTGTAAAATGG + Intergenic
989889747 5:46955463-46955485 CTGTTGCCTCTGCTGGAAAAAGG + Intergenic
989890652 5:46973364-46973386 CTGTTGCCTCTGCTGGAAAAAGG + Intergenic
989892124 5:47002341-47002363 CTGTTGCCTCTGCTGGAAAAAGG + Intergenic
990268039 5:54099824-54099846 CTGTTTTCTCATCTGTAAAATGG - Intronic
990310126 5:54529790-54529812 CTGTTTCCTCATGTGTAACATGG + Intronic
990729848 5:58796389-58796411 CAGTTTACCCAGCTATAACATGG + Intronic
991436642 5:66602880-66602902 CTGTTTCCTCATCTGTAAAATGG + Intronic
991462824 5:66877400-66877422 CAGTTTCCTCATCTGCAACATGG - Intronic
991613382 5:68471065-68471087 ATGTTTGCTCATCTGGAAAATGG - Intergenic
991972765 5:72156899-72156921 CTGTTTCCTCATCTGTAAAAGGG - Intronic
991989770 5:72326045-72326067 CTTTTTACTCAGCTGTTAGAAGG - Intronic
992169034 5:74084156-74084178 CTGTTTTCTCACCTGTAAAACGG + Intergenic
992541407 5:77768343-77768365 CAGTTTTCTTAGCCGGAACATGG - Intronic
992871420 5:81009134-81009156 CTGTTTCCTCATCTGTAAAAGGG + Intronic
993164584 5:84335927-84335949 CTGTTTCCTCAGATGGAGGAAGG + Intronic
994005184 5:94828929-94828951 CTGTTTACTCCCCTGGAAAGGGG - Intronic
994128019 5:96191421-96191443 CTTTTTACTCAACTGTAAAATGG - Intergenic
994332111 5:98518638-98518660 CAGTTTACTCATCTGTAAAATGG + Intergenic
994659787 5:102640125-102640147 CTGTTTCCTCACCTGCAAAATGG - Intergenic
994991338 5:107000246-107000268 CTGTTCACTCCCCTGGAAAAAGG - Intergenic
995002531 5:107151880-107151902 CAGTTTTCTCATCTGGAAAATGG - Intergenic
995061404 5:107814951-107814973 CCGTTTACTCATCTGTAAAATGG - Intergenic
995413069 5:111880182-111880204 CTGTTTACTCATCTGTAAAATGG + Intronic
995476080 5:112549585-112549607 CTGTTTTCTCATCTGAAAAATGG - Intergenic
995751363 5:115456464-115456486 CTGTTTCCTCATCTGTAAAATGG - Intergenic
995918261 5:117277363-117277385 CTGTTTTCCCATCTGAAACAAGG - Intergenic
996242489 5:121221069-121221091 CTGTTTACTCCCCTGGAAAGGGG + Intergenic
996355140 5:122587227-122587249 CAGTTTACTCATCTGTAAAATGG + Intergenic
996876127 5:128242436-128242458 CTGTTGACTAAGCTGGAATTCGG - Intergenic
997598741 5:135125127-135125149 CTGTTTACTTATCTGTAAAATGG + Intronic
997612140 5:135222793-135222815 CAGTTTACTCATCTGGAAAATGG - Intronic
997690868 5:135826691-135826713 CTGTTTACTCAGCTGTAGAATGG - Intergenic
997695110 5:135855470-135855492 CTGTTTTCTCATCTGTAAAATGG - Intronic
998385948 5:141757194-141757216 CTGTTTCCTCATCTGTAAAATGG + Intergenic
998570241 5:143250568-143250590 CTGTTTTCTCATCTGTAAAATGG - Intergenic
998608997 5:143667276-143667298 CTGTTTTCTCAGCTGCAAAATGG - Intergenic
998680170 5:144458223-144458245 CAGTTTGCTCACCTGTAACATGG - Intronic
998705607 5:144756207-144756229 CTGTTTCCTCATCTGTAAAATGG + Intergenic
998806754 5:145924706-145924728 CTGTTTCCTCATCTGTAAGATGG + Intergenic
998888832 5:146724280-146724302 CAGTTTCCTCAGCTGTAAAATGG + Intronic
999030096 5:148281272-148281294 CTGTTCACTCACCTGGAAAGGGG - Intronic
999142956 5:149374748-149374770 CAGTTTCCTCACGTGGAACATGG - Intronic
999155344 5:149453794-149453816 CAGTTTCCTCAGCTGTAAAATGG - Intergenic
999176697 5:149636832-149636854 CTGTTTTCTCATCTGTAAAATGG + Intergenic
999212092 5:149898593-149898615 CTGTTTTCTCAGCTATAAAATGG + Intronic
999404542 5:151295259-151295281 CAGTTTACTCATCTGTAAAATGG + Intronic
999407414 5:151319053-151319075 TTGTTTCCTCAGCTGCAAAATGG + Intronic
999519467 5:152335925-152335947 CAGTTTACTCATCTGCAAAATGG + Intergenic
999605218 5:153306584-153306606 CTGTTTTCTAAGCTGAAAAATGG + Intergenic
999651572 5:153773195-153773217 CTGTTTCCTCATCTGTAAAATGG - Intronic
999780469 5:154845724-154845746 CTGTTTCTTCAGTTGGAAAATGG - Intronic
999835275 5:155363755-155363777 ATGTTAACTCAGGTGGAAAATGG - Intergenic
1001086668 5:168704987-168705009 CAGTTTCCTCAGCTGTAAAATGG - Intronic
1001140236 5:169138080-169138102 CAGTTTTCTCATCTGGAAAATGG + Intronic
1001222033 5:169908911-169908933 CTGTTTTCTCATCTGCAAAATGG - Intronic
1001260554 5:170224943-170224965 CAGATTACTCAGCTGGGAAATGG - Intergenic
1001487358 5:172129086-172129108 CTGTGTCCTCAGCTGTAAAATGG + Intronic
1001516305 5:172357551-172357573 CTGTTTCCTCATCTGTAAAATGG + Intronic
1001596457 5:172901970-172901992 CAGTTTCCCCAGCTGTAACATGG - Intronic
1001875461 5:175196244-175196266 CTGTTTACTTATCTGCAAAATGG + Intergenic
1002101738 5:176861310-176861332 CTGTTTCCTCACCTGCAAAATGG - Intronic
1002203069 5:177542318-177542340 CTGTTTGCTCATCTGTAAAATGG + Intronic
1002421810 5:179152916-179152938 CTGTTTCCTCATCTGTAAAATGG + Intronic
1002546297 5:179947602-179947624 CTGTTTCCTCATCTGTAAAACGG + Intronic
1002559141 5:180069676-180069698 CTGTTTGCTCATCTGTAAAATGG - Intronic
1002810622 6:624559-624581 CCATTTCCTCATCTGGAACATGG - Intronic
1002818625 6:701653-701675 CTCTTTATTCAGTGGGAACAAGG + Intergenic
1002902573 6:1422576-1422598 CTGTTTTCTCACCTAGAAAATGG + Intergenic
1002919584 6:1557406-1557428 CAGTGTACTCAGGTGGAAAATGG - Intergenic
1003153556 6:3572449-3572471 CTGTTTCCTCAACTGTAAAATGG - Intergenic
1003258831 6:4497644-4497666 CTGTTTCCCCAGCTGTACCATGG - Intergenic
1003789827 6:9533501-9533523 CTGTTTCCTCACCTGTAAAATGG - Intergenic
1004049832 6:12065615-12065637 CTGTTTGCTCCTCTGGAAAATGG + Intronic
1004443945 6:15680522-15680544 CTGTTTCCTCACCTGTAAAATGG + Intergenic
1005376314 6:25186022-25186044 CTGTTTACTCCCCTGGAAAGGGG - Intergenic
1005425063 6:25693910-25693932 CAGTTTCCTCATCTGGAAGATGG + Intronic
1006078372 6:31548951-31548973 CTGTTTCCTCAGCTGGGAAATGG - Intronic
1006349192 6:33508497-33508519 CTTTTGAGTCAGCTGGAACTGGG + Intergenic
1006562244 6:34923577-34923599 CTGTTTCCTCATCTGTAAAAGGG - Intronic
1006563871 6:34937413-34937435 CTGTTTCCTCATCTGGTAAATGG + Intronic
1006921634 6:37631483-37631505 CAGTTTCCCCATCTGGAACATGG + Exonic
1007251725 6:40499878-40499900 CAGTTTTCTCATCTGGAAAATGG + Intronic
1007281283 6:40714155-40714177 CAGTTTCCTCATCTGGAAAATGG - Intergenic
1007382360 6:41499026-41499048 CAGTTTACTCATCTGTAAGATGG - Intergenic
1007415501 6:41689085-41689107 CAGTTTTCTCAGCTGCAAAATGG - Intronic
1007421556 6:41722927-41722949 CTGCTTCCTCATCTGTAACATGG - Intronic
1007481704 6:42154460-42154482 CTGTTTTCTCATCTGTAAAATGG - Intergenic
1007727389 6:43924679-43924701 CAGTTGCCTCAGCTGTAACATGG + Intergenic
1008418326 6:51268718-51268740 CTGTTTTCTCTGGAGGAACAGGG - Intergenic
1008640549 6:53458139-53458161 CAGTGTCATCAGCTGGAACATGG + Intergenic
1008691718 6:53986765-53986787 CTGTTTCCTCAGCTGAAAATGGG - Intronic
1008783375 6:55135722-55135744 CTGTTTTCTCATCTATAACATGG - Intronic
1010002338 6:70959670-70959692 CTGTTTCCTCATCTGGAAAATGG + Intergenic
1010109645 6:72210757-72210779 CGGTTTCCTCATCTGTAACATGG + Intronic
1010212783 6:73375258-73375280 CTGTTCTCTCAGCTGGGAAAAGG - Intronic
1010447027 6:75959853-75959875 CTGTTCACTCCCCTGGAAAAGGG - Intronic
1010587125 6:77666572-77666594 CAGTTTACTCATCTGTAAAATGG - Intergenic
1010780254 6:79937511-79937533 CAGTTTACTCACCTGGAAAATGG + Intronic
1010811541 6:80305998-80306020 CAGTTTTCTCATCTGGAAAATGG + Intronic
1011580487 6:88858637-88858659 CAGTTTCCTCATCTGGAAAATGG - Intronic
1011603246 6:89079328-89079350 CTGTTTCCCCAGCTGTAAAATGG + Intergenic
1011751073 6:90455229-90455251 CAGTTTACTCATCTGTAAAATGG + Intergenic
1012060118 6:94467851-94467873 ATGTTTACCCAACTGTAACATGG + Intergenic
1012343500 6:98157141-98157163 CTGTTTACTCCCCTGGAAAGGGG - Intergenic
1012477035 6:99624951-99624973 CAGTTTACTCATCTGTAAAATGG + Intergenic
1012864117 6:104596989-104597011 CTGTTTTCTCAGTCGGAAAATGG - Intergenic
1013029515 6:106319093-106319115 CTGTTTTCTCATCTGTAACATGG + Intronic
1013220464 6:108073584-108073606 CTGTTTACTAATCTGTAAAATGG - Intronic
1013343660 6:109238943-109238965 CCGTTTCCTCATCTGTAACATGG - Intergenic
1013515117 6:110877613-110877635 CTGTTTCCTCATCTGTAAAATGG + Intronic
1014157688 6:118130145-118130167 CTGTTTCCACAACTGTAACATGG + Intronic
1014569020 6:122986342-122986364 CTGTTTACTCCACTGGAAAGGGG + Intergenic
1015362663 6:132358438-132358460 CTGTTTTCTCATCTAGAAAATGG + Intronic
1015860903 6:137678888-137678910 CTGATTCCTGCGCTGGAACAGGG + Intergenic
1015986025 6:138884846-138884868 CAGTTTTCTCATCTGTAACATGG - Intronic
1017073618 6:150599042-150599064 CTGTTTCCTCATCTGTAAAATGG - Intergenic
1018001188 6:159580020-159580042 CAGTTTCCTCATCTGGAAAATGG - Intergenic
1018503323 6:164437133-164437155 CTGACTAATCAGCAGGAACAGGG - Intergenic
1019309378 7:352799-352821 CTGTTTTCTCACCTGTAAAATGG - Intergenic
1019310124 7:356413-356435 CTGTTTTCTCATCTGTAAAATGG - Intergenic
1019545901 7:1576009-1576031 CTGTTTTCTCATCTGTAAAATGG + Intergenic
1019707230 7:2502505-2502527 CAGTTTACTCAGCTGCCAAATGG - Intergenic
1020127550 7:5541462-5541484 CAGTTTACCCATCTGAAACATGG - Intronic
1020129619 7:5552340-5552362 CTGTTTTCTCATCTGTAAAATGG + Intronic
1020838070 7:13179676-13179698 CTGTTTCCTCATCTGTAAAACGG - Intergenic
1020993989 7:15238984-15239006 CTGTTTCCTCATCTGTAAAATGG - Intronic
1021134672 7:16950854-16950876 ATGTTTACTCAGCTAGAAGTGGG - Intergenic
1021241893 7:18212554-18212576 TTGTTTACTCATCTGTAAAATGG + Intronic
1021649786 7:22822142-22822164 CTGTTTCCTCACCTGTAAAATGG + Intronic
1021703482 7:23343283-23343305 CAGTTTACTCATCTGTAAAATGG - Intronic
1021784705 7:24140342-24140364 CAGTTTCCTCAGCTGTAAAATGG + Intergenic
1021913842 7:25412073-25412095 CTGTTTTCTCATCTGTAAAATGG + Intergenic
1021963335 7:25894150-25894172 CAGTTTGCTCAGCTGGTAAATGG - Intergenic
1022130831 7:27402930-27402952 CAGTTTTCTCACCTGGAAAATGG - Intergenic
1022251193 7:28610213-28610235 CTGTTCACCCAGCTGGCAGAGGG - Intronic
1022495643 7:30851336-30851358 CTGTTTACTCATCTGGAAAATGG + Intronic
1022496319 7:30855190-30855212 CAGTTTCCTCATCTGGAAAATGG + Intronic
1022546479 7:31193832-31193854 CAGTTTACTCATCTGTAAGATGG + Intergenic
1022573620 7:31476642-31476664 CTGTTTTCTCAGCTGTAAAATGG - Intergenic
1022660637 7:32363296-32363318 CTGTTTCCTCATTTGGAAAATGG - Intergenic
1022682128 7:32558618-32558640 CTGTTTTCTTACCTGGAAAAAGG - Exonic
1023025349 7:36044812-36044834 CTGTTTCCTTAGCTGTAAAATGG + Intergenic
1023167727 7:37359385-37359407 CAGTTTACTCATCTGTAAAATGG + Intronic
1023186094 7:37534684-37534706 CTGTTTCCTCATCTGTAACATGG - Intergenic
1023319697 7:38980894-38980916 CTGTGTCCTGAGCTGGATCATGG - Intronic
1023372328 7:39523994-39524016 CTGTTTTCTTAGCTGTAAAATGG - Intergenic
1024243338 7:47451997-47452019 CAGTTTTCTCATCTGGAAAAGGG + Intronic
1024458398 7:49634490-49634512 CTGTTTCCTCATCTAGAAAATGG + Intergenic
1025245239 7:57312238-57312260 CAGTTTTCTCATCTGGAAAAAGG - Intergenic
1025996405 7:66530114-66530136 CTGTTTGCTCAGTTGCAAAATGG - Intergenic
1026277541 7:68893250-68893272 CAGTTTACTCATCTGTAAAACGG - Intergenic
1026836935 7:73645863-73645885 CTGTTTCCTCATCTGTAAAATGG + Intergenic
1027150914 7:75733067-75733089 GTTTTTACTTAGCTGGAAAATGG - Intronic
1027483305 7:78726393-78726415 CAGTTTATTCAGCTCAAACAAGG - Intronic
1027599251 7:80218891-80218913 CTGTTTACTTTGCTGAAACAAGG - Exonic
1027631211 7:80608604-80608626 CTGTTTACTCATTTGTAAAATGG - Intronic
1028423348 7:90658359-90658381 CTGTATACTCAGATGGTAGAAGG + Intronic
1028609944 7:92699902-92699924 CTGTTTCCTCACCTGCAAGATGG + Intronic
1028627988 7:92898703-92898725 CTGTTCACTCCCCTGGAAAAAGG - Intergenic
1029203813 7:98856367-98856389 CGGTTTGCTCATCTGGAAAATGG - Intronic
1029276884 7:99410838-99410860 CTGTTTCCTCATCTGTAAAATGG - Intronic
1029611499 7:101628943-101628965 CAGTTTCCTCATCTGGAAAATGG - Intronic
1029797995 7:102915182-102915204 CAGTTTTCTCATCTGGAACATGG + Intronic
1030083047 7:105793849-105793871 CTGTTTTCTCATCTGAAAGATGG - Intronic
1030096776 7:105907600-105907622 CAGTTTACTCATCTGTAAAATGG - Intronic
1030232148 7:107220006-107220028 CTGTTTACCCATCTGTAAAATGG - Intronic
1032338854 7:131052417-131052439 CTACTTACTCAGCTGTTACAGGG + Intergenic
1033234758 7:139629521-139629543 CTGTTTCCCCATCTGGAAAATGG - Intronic
1033458948 7:141528055-141528077 CTGTTCCCTCTGCTGGGACAGGG + Intergenic
1033670842 7:143491258-143491280 CTGGAGACTAAGCTGGAACAAGG + Intergenic
1034077376 7:148245291-148245313 CAGTTTCCTCAACTGTAACATGG + Intronic
1034965303 7:155387160-155387182 CTGTTTCCTCATCTGCAAAATGG - Intronic
1035891815 8:3352951-3352973 CAGTTTTCTCATCTGTAACATGG - Intronic
1036397164 8:8379121-8379143 GTGTTTTCTGAGCTGGATCAGGG + Intronic
1036752579 8:11452665-11452687 CTGTTTCCTCACCTGTAAAATGG - Intronic
1036782418 8:11658783-11658805 CTGTTTTCTCATCTGGAGAATGG - Intergenic
1037206733 8:16331059-16331081 CTGTTTACTCACCTGCCAGATGG + Intronic
1037256287 8:16958894-16958916 CTGTTTCCTCATCTGTAAAATGG - Intergenic
1038125336 8:24667056-24667078 CAGTTTTCTCAGCTGCAAAATGG - Intergenic
1038523961 8:28257411-28257433 CTGTTTTCTCCGCTGCAAAACGG + Intergenic
1038777823 8:30546827-30546849 CTGTTTCCTCATCTGTAAAATGG - Intronic
1038853650 8:31306840-31306862 CTGTTTTCTCATCTGTAAAATGG - Intergenic
1039382412 8:37098661-37098683 CTGTTTTCTCATCTGTAAAAGGG - Intergenic
1039906249 8:41788550-41788572 CAGTTTCCTCATCTGTAACATGG + Intronic
1040046228 8:42966754-42966776 CTGTTTTCTCATCTGCAAAATGG + Intronic
1040495733 8:47963868-47963890 CTGTTTCCTCATCTGTAAAATGG + Intronic
1041876136 8:62689884-62689906 CAGTTTCCTCAGCTGTACCAAGG + Intronic
1041960553 8:63610561-63610583 CAGTTTTCTCATCTGTAACATGG + Intergenic
1042307236 8:67344066-67344088 CTGTTCACTCGGCAGGAGCAGGG - Intergenic
1042678430 8:71349692-71349714 CTGTTTTCTCATCTGTAAAATGG - Intronic
1043442639 8:80289822-80289844 CTGTTTTCTCATCTGTAAAATGG - Intergenic
1043497236 8:80815736-80815758 CTGTTTACTCATTTGCAAAATGG + Intronic
1044409660 8:91868966-91868988 CTGCTTCCCCAGCTGGCACAGGG - Intergenic
1044556313 8:93565955-93565977 CTGTTTCCTCAGCTGGGAAGTGG + Intergenic
1045129869 8:99139298-99139320 CTGTTTCCTCATCTGTAAAATGG - Intronic
1045497831 8:102723062-102723084 CAGTTTCCTCAACTGGAAAATGG + Intergenic
1045772777 8:105763633-105763655 CAGTTTCCTCATCTGGAAAATGG - Intronic
1046024054 8:108700802-108700824 AGGTTTACACAGCTGGAGCATGG + Intronic
1047030044 8:120866853-120866875 CTGTTTCCTCATCTGTAAAATGG - Intergenic
1047313361 8:123710765-123710787 CAGTTTCCTCAGCTGGAAAATGG + Intronic
1047345159 8:124020718-124020740 CTGCTTCCTCAGCTGTAAAATGG + Intronic
1047497315 8:125417623-125417645 CCCTTTCCTCAGCTGGAAAATGG + Intergenic
1047545328 8:125811092-125811114 CAGTTTCCTCATCTGGAAAATGG - Intergenic
1047635498 8:126757277-126757299 CAGTTTACTCATCTGTAAAATGG - Intergenic
1047706800 8:127507160-127507182 CTGTTGCCTAAGCTGGAGCATGG - Intergenic
1047852335 8:128870489-128870511 ATGTTTCCTCATCTGGAAAACGG - Intergenic
1048054958 8:130854696-130854718 CTGTTTCCTCATCTGTAAAATGG - Intronic
1048290442 8:133177294-133177316 CTGTTTTCACAGCTGTAAAATGG + Intergenic
1048315072 8:133355732-133355754 CGGTTTACTCATCTGTAAAATGG + Intergenic
1048836660 8:138525128-138525150 CTGTTTCCTCATCTGGAAAATGG + Intergenic
1049030668 8:140035042-140035064 CTGTATACACAGCTGGAGGAGGG + Intronic
1049240331 8:141534637-141534659 CTGTCTTCTCCTCTGGAACATGG + Intergenic
1049338468 8:142099150-142099172 CAGTTTCCTCATCTGAAACATGG - Intergenic
1050651562 9:7782436-7782458 CTGCTTCCTCAGCTGGAAAATGG - Intergenic
1051018586 9:12512779-12512801 CAGTTTCCTCAGCTGTAAAATGG - Intergenic
1051388240 9:16534702-16534724 CTATTTACTCAGCAGGAAGATGG + Intronic
1052101512 9:24451960-24451982 CTGTTTCCTCATCTGGATCCTGG - Intergenic
1052820064 9:33131287-33131309 CTGTTTCCTCACCTGTGACATGG + Intronic
1053416191 9:37948253-37948275 CTGTTTACTCATCTGCAAATTGG + Intronic
1053514106 9:38715294-38715316 CTGTTTTCTCATCTGTAAAATGG + Intergenic
1054710739 9:68508627-68508649 TTGTTTACTCAGCCTGAAAAAGG + Intronic
1054720867 9:68602429-68602451 CAGTTTCCTCATCTGGAAAATGG + Intergenic
1054743462 9:68831402-68831424 CTGTTTTCTCATCTGTAAAATGG - Intronic
1054949871 9:70837942-70837964 CTGTTTACTCAACTGTAAAGGGG + Intronic
1055640457 9:78315340-78315362 CAGTTTCCTCATCTGGAAAATGG + Intronic
1055729948 9:79270235-79270257 CTGTTTACTCATCTTTAAAATGG - Intergenic
1056463402 9:86829868-86829890 CAGTTTTCTCAGCTGTAAAATGG + Intergenic
1056840003 9:89991148-89991170 CTGTTTTCTCATCTGCAACATGG + Intergenic
1057187100 9:93063058-93063080 CAGTTTCCTCATCTGGAAAATGG + Intronic
1057480688 9:95442808-95442830 TTGCTTACACAGCTGTAACATGG + Intergenic
1057805007 9:98213499-98213521 CTGTTTCCTCATCTGTAAAAGGG + Intronic
1057825027 9:98366128-98366150 CAGTTTCCTCATCTAGAACATGG + Intronic
1057942535 9:99297501-99297523 CTGTTTTCTCACCTGCAAAATGG - Intergenic
1058268129 9:102933225-102933247 ATGTTTAATGAGCTGGAACCAGG + Intergenic
1058536473 9:105965344-105965366 CTGTATAGTCTTCTGGAACATGG + Intergenic
1058547041 9:106071853-106071875 CTGTTTCCTCAACTGTAAAATGG - Intergenic
1058572603 9:106363788-106363810 CTGTGTTCTCACATGGAACAAGG + Intergenic
1058636849 9:107045995-107046017 CTGTTTCCTCATCTGTAAAATGG + Intergenic
1058793072 9:108470520-108470542 CAGTTTCCTCATCTGGAAAATGG + Intergenic
1058879863 9:109276979-109277001 CTGTTTTCTCATCTGTAAAATGG - Intronic
1059348557 9:113648810-113648832 CTGGTTTCTCATCTGGAAGACGG - Intergenic
1059424734 9:114213752-114213774 CAGTTTTCTCATCTGGAAAATGG - Intronic
1059515860 9:114894603-114894625 CTGTTTCCTCATCTGCAACATGG + Intronic
1059540160 9:115122323-115122345 CTGTTTACCCTGCTAGATCATGG + Intergenic
1059787917 9:117606785-117606807 CTATGTCCTCAGCTGTAACATGG - Intergenic
1059825242 9:118020810-118020832 CTGTTTCCTCATCTGTAAAATGG + Intergenic
1059873153 9:118601004-118601026 CTGTTTTCTCATCTGCAAGATGG + Intergenic
1059973708 9:119693849-119693871 CTGGTGACTTAACTGGAACAAGG + Intergenic
1060029414 9:120201540-120201562 CGGTTTTCTCATCTGTAACATGG - Intergenic
1060047453 9:120351932-120351954 CAGTTTTCTCAGCTGCAAAATGG + Intergenic
1060048596 9:120360293-120360315 CTGTTTCCTCATCTGCAAGAGGG - Intergenic
1060160216 9:121355688-121355710 CTGTTTCCTCACCTGTAAAATGG - Intronic
1060205615 9:121681097-121681119 CTGTTTCCTCACCTGGGAAATGG - Intronic
1060228656 9:121811527-121811549 CTGTTTCCTCAGCTGTATAAGGG + Intergenic
1060237472 9:121875562-121875584 GGTTTTACTCAGCTGGAAGAAGG + Intronic
1060256936 9:122039516-122039538 CTGTTTCCTCATCTGTAAAATGG - Intronic
1060426777 9:123512833-123512855 CAGTTTCCTAAGCTGGAAAATGG + Intronic
1060475245 9:123982130-123982152 CAGTTTCCTCATCTGGAAAAGGG - Intergenic
1060735264 9:126062730-126062752 CTGTTTTCTCATCTGTAAAATGG - Intergenic
1060749554 9:126159967-126159989 CTGTTTCCTCATCTACAACACGG - Intergenic
1060797551 9:126522813-126522835 CTGTTTCCTCAGCTGTAAAATGG - Intergenic
1060798281 9:126527141-126527163 CTGTTTGCTCTTCTGGAAAAGGG + Intergenic
1060803731 9:126562059-126562081 CAGTTTCCTCAGCTGAAAAACGG - Intergenic
1060850916 9:126874688-126874710 GTGTGTGCACAGCTGGAACAAGG - Intronic
1060917549 9:127400051-127400073 CTGTTTACACATCTGTAAAATGG - Intronic
1060926999 9:127462014-127462036 CAGTTTTCTCACCTGGAAAATGG - Intronic
1060941874 9:127547211-127547233 CTGTTTCCTCAGCTGTAACATGG + Intronic
1060950759 9:127600914-127600936 CTGTTTCCTCATCTGTAAAATGG + Intergenic
1060992113 9:127855032-127855054 CTGTTTCCTCATCTGCAAAATGG - Intergenic
1061092681 9:128435475-128435497 CTGTTTCCTCATCTGGAAAATGG + Intronic
1061266094 9:129505812-129505834 CAGTTTGCTCAGCTGTAAAATGG + Intergenic
1061285636 9:129620756-129620778 CTGTTTCCTCACCTGAAAAATGG + Exonic
1061379243 9:130244171-130244193 CTGTTTCCTCATCTGGAACTGGG - Intergenic
1061495446 9:130971321-130971343 CTGTTTTCTCATCTGGAAGTGGG + Intergenic
1061502359 9:131011294-131011316 CAATTTTCTCAGCTGAAACATGG - Intronic
1061519620 9:131110400-131110422 CTGTTTCCTCACCTGTAAAATGG - Intronic
1061530378 9:131207329-131207351 CTGTGATCTCAGCTGGAAGAAGG + Intronic
1061543936 9:131293096-131293118 CAGTTTACTCATCTGTAAAATGG - Intronic
1061650289 9:132042370-132042392 CTGTTTTCTCATCTGTAAAATGG - Intronic
1062097334 9:134710129-134710151 CAGTTTCCTCAGCTGGAAAGTGG + Intronic
1062122324 9:134840433-134840455 CAGTTTCCTCAGCTGGAAAATGG - Intronic
1185716777 X:2349002-2349024 CTTTTTGCACAGCTGGGACAGGG + Intronic
1186462352 X:9758375-9758397 CTGTTTTCTCAGCTGTGAAATGG - Intronic
1186705362 X:12134952-12134974 CAGTTTCCTCAGCTGTAAAATGG - Intergenic
1186766353 X:12774234-12774256 CAGTTTATTCATCTGTAACATGG + Intergenic
1187154140 X:16708266-16708288 CAGTTTACTCAGCCTGACCATGG - Intronic
1187205839 X:17180409-17180431 CTGTTTCCTCACCTGGAAAAAGG + Intergenic
1187341150 X:18422830-18422852 CTGTTTCTTCATCTGGAAAATGG + Intergenic
1187431269 X:19227489-19227511 CTGTTTTCTCATCTGTAAAAGGG - Intergenic
1187815436 X:23226598-23226620 CTGTTTGCTCCACTTGAACAGGG + Intergenic
1187832589 X:23397949-23397971 CTGTTTTCTCATCTGTAAAATGG + Exonic
1187903796 X:24048630-24048652 CTGTTTTCTCACCTGTAAAATGG + Intergenic
1187946057 X:24427282-24427304 CTGTTTGATCACCTGGAACTAGG - Intergenic
1187983060 X:24779769-24779791 CAGTTTTCTCAGCTGTAACGTGG - Intronic
1189273946 X:39771289-39771311 CTGTTTCCTCATCTGTAAAATGG + Intergenic
1189707234 X:43770995-43771017 GTGTTGACTAAGATGGAACATGG - Intronic
1189842995 X:45101933-45101955 CAGTTTCCTCAGCTGAAAAAAGG - Intronic
1190282916 X:48942870-48942892 CTGTTTCCTCATCTGTAAAATGG - Intronic
1190324050 X:49195854-49195876 CTGTTTATTCATCTGTAAAAAGG - Intronic
1190448624 X:50555980-50556002 CTGCTTACTCAGCAGGCAAATGG + Intergenic
1190492292 X:50994122-50994144 CTGTCTCCTGAGCTGGAACCTGG - Intergenic
1190747192 X:53331507-53331529 TTGTTTCCTCATCTGGAAAATGG - Intergenic
1190879551 X:54483003-54483025 CGGTTTTCTCATCTGGAAAATGG - Intronic
1190916481 X:54814959-54814981 CGGTTTTCTCATCTGTAACAGGG - Intronic
1190935503 X:54995630-54995652 CAGTTTTCTTATCTGGAACATGG + Intronic
1190951325 X:55146495-55146517 CTGTTTCCTCATCTGTAAAATGG - Intronic
1190982156 X:55465756-55465778 CAGTTTACTCATCTGGAAAAAGG - Intergenic
1190986542 X:55507426-55507448 CAGTTTACTCATCTGGAAAAAGG + Intergenic
1191056480 X:56246505-56246527 CTGTTTTCTCATCTGTAAAATGG - Intronic
1191168557 X:57418217-57418239 CTGTTCACTCCCCTGGAAAAAGG - Intronic
1191736397 X:64393220-64393242 CAGTTTCCTCATCTGTAACATGG + Intronic
1191920857 X:66255526-66255548 CTGTTTTCTCATCTGGAAAATGG + Intronic
1192081966 X:68057063-68057085 CTGTTTCCTCAGCTGTAGAACGG - Intronic
1193081607 X:77412028-77412050 CTGTTCACTCACCTGGAAAGGGG - Intergenic
1193177197 X:78408706-78408728 CTGTTTTCTTATCTGGAAAATGG - Intergenic
1194514346 X:94832379-94832401 CATTTTACTCATCTGGAAAATGG - Intergenic
1194959212 X:100215598-100215620 CAGTTTACTCATCTGCAAAATGG + Intergenic
1196571255 X:117268519-117268541 CTGTTCACTCCCCTGGAAAAGGG + Intergenic
1197365596 X:125561906-125561928 CTGTGCACTCCCCTGGAACAGGG + Intergenic
1197717614 X:129720637-129720659 CTGTTCCCTCATCTGGAAAATGG - Intergenic
1197809833 X:130431318-130431340 CTGTTTCTTCAGCTGTAAAATGG + Intergenic
1197840889 X:130745184-130745206 CTGTTTTCTCAACTGTAAAATGG - Intronic
1198395237 X:136213062-136213084 CTGTTTTCTCATCTGGGAAACGG - Intergenic
1198478621 X:137019667-137019689 CTGTTTTCTCAGCTGGAAAATGG - Intergenic
1198645520 X:138802069-138802091 CTGTTTACTCCCCTGGAAAGGGG - Intronic
1198684276 X:139211245-139211267 TTGTTTCCTCATCTGGAAAATGG - Intronic
1198701753 X:139404527-139404549 CTGTTTTCTCACCTGTAAAATGG + Intergenic
1199315583 X:146373824-146373846 CAGTTTACTCATCTGTAAAATGG + Intergenic
1199453164 X:147996330-147996352 CAGTTTACTCATCTGCAAAATGG - Intronic
1199782807 X:151078553-151078575 CTGTTTACTCAGAAGTAAAATGG - Intergenic
1200254303 X:154571531-154571553 CAGTTTCCTCATCTGTAACAAGG + Intergenic
1200263466 X:154632877-154632899 CAGTTTCCTCATCTGTAACAAGG - Intergenic
1201979371 Y:19890942-19890964 CTGTTCACTCATCTGGAAAGGGG - Intergenic