ID: 1106573896

View in Genome Browser
Species Human (GRCh38)
Location 13:30956589-30956611
Sequence GTCTCCTACAGATAAGACTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 86}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106573896 Original CRISPR GTCTCCTACAGATAAGACTA AGG (reversed) Intronic
902899542 1:19505033-19505055 CTTTCCTTCAGATAAGACTGGGG - Intergenic
903432206 1:23314757-23314779 ATCTCCTACAGAAAGGAATATGG + Intronic
903564351 1:24253547-24253569 ATCTCTTACAGATGAGAATATGG + Intergenic
907011073 1:50963678-50963700 ATCTACTACAGATAAGAGAAGGG + Intronic
907644671 1:56230391-56230413 GTCTCCCACAGATTAGGCTATGG - Intergenic
918174724 1:182033288-182033310 GTTTCCTTCAGAAAAGACTGGGG - Intergenic
921336586 1:214093015-214093037 GTCTCCTGCAGCTAGGACTCTGG - Intergenic
921959021 1:221014641-221014663 TTATCCCACAGATAAGATTAAGG + Intergenic
922522087 1:226263073-226263095 GTCTGCAAAAGATAAAACTATGG + Intronic
923536761 1:234858436-234858458 GTCTACTACAAATAAGAGGAAGG - Intergenic
1063847070 10:10142065-10142087 CTCTCCTGCAGACAAGTCTAAGG - Intergenic
1064059471 10:12125708-12125730 GTCACCTACTGATTAAACTATGG - Intergenic
1064075589 10:12266061-12266083 GGCTCCTACAGATAACACATTGG - Intergenic
1069130251 10:64692027-64692049 GGCTGCTACAGAAAATACTATGG + Intergenic
1069739084 10:70675987-70676009 ATCTCCTACACATGAGACAATGG - Intronic
1075508113 10:123044074-123044096 GTAGCCTACAGATAAGAATTGGG + Intronic
1076989621 11:265444-265466 GTTTATTACAGATAAGACTAAGG - Intergenic
1078682728 11:13494220-13494242 GTCTCCAACAGATAAACCCACGG + Intronic
1082128431 11:48457776-48457798 CTCTCCTACAGCTAGGATTATGG + Intergenic
1082561975 11:54628701-54628723 CTCTCCTACAGCTAGGATTATGG + Intergenic
1091861765 12:3791780-3791802 GGCTTCTACACCTAAGACTAAGG - Intronic
1095165921 12:38971710-38971732 GTCTCATGCTGATAATACTAGGG + Intergenic
1097062640 12:56297299-56297321 GTCACCCACAGATAATACTAAGG + Intronic
1100848942 12:98689142-98689164 GTTTCCTACAGTTTATACTATGG - Intronic
1100900038 12:99227784-99227806 GTCTCCTACAAATCAGCGTAAGG + Intronic
1106573896 13:30956589-30956611 GTCTCCTACAGATAAGACTAAGG - Intronic
1107052286 13:36064320-36064342 TTTTCCTGCAGATAAGACAAAGG + Intronic
1111006122 13:82251445-82251467 TTCTCCTACAGAAAACTCTACGG + Intergenic
1112641057 13:101275560-101275582 GTCTGTTAGAGATAAGACTCTGG - Intronic
1113220006 13:108089249-108089271 GTTTCCTATAGAGAACACTATGG - Intergenic
1116745417 14:48811900-48811922 GTCTCCTACAAATAAAAGGAGGG + Intergenic
1117308182 14:54496642-54496664 GTCTCCTTCAGAGAAGAGCATGG - Intergenic
1117339203 14:54779509-54779531 GTCTCATACAGAGAAGACAGAGG + Intronic
1117404003 14:55384038-55384060 GCCTGCCACAGATAAGACTGTGG + Intronic
1121167235 14:91816137-91816159 GATTCCTAGAGATAAGACTATGG + Intronic
1123950613 15:25269594-25269616 GTCTTTTACAGAAAAGACTGTGG + Intergenic
1124551381 15:30683893-30683915 GTATCCCACAGAGAAGACCAGGG - Intronic
1124679866 15:31721772-31721794 GTATCCCACAGAGAAGACCAGGG + Intronic
1129483553 15:75845821-75845843 GTCTGCTGCAGATAAAAATAAGG + Intronic
1130850868 15:87792470-87792492 GTCTGGTAGAGATAAGATTAAGG + Intergenic
1140806379 16:78536010-78536032 GGCTCCCACAGCCAAGACTAAGG - Intronic
1141147287 16:81540253-81540275 CTCTCCAACAGGCAAGACTAAGG - Intronic
1146135678 17:30318902-30318924 ATTTCCTACAGATAAAACTGTGG - Exonic
1147877318 17:43630909-43630931 GTCTGCTACAGGTAAGACTTGGG - Intergenic
1150474866 17:65467249-65467271 CTCTCCTCCACAAAAGACTAGGG + Intergenic
925545695 2:5013389-5013411 GTCTCCTTCAGCTAAGAACAAGG - Intergenic
926389390 2:12372379-12372401 GTTTCCTAGAAAGAAGACTAAGG - Intergenic
930066989 2:47335174-47335196 GTCTCCCTCATCTAAGACTAAGG - Intergenic
933406993 2:81873250-81873272 GTCTCCCACAGATAAAATCAGGG + Intergenic
941419759 2:165268718-165268740 CTCATCTACAGATAAGACTTAGG - Intronic
943708652 2:191063655-191063677 GTATTCCACATATAAGACTATGG + Intronic
944290954 2:198004438-198004460 GTGTCCTACTGATATGACTTAGG + Intronic
945762002 2:213925281-213925303 CTCTCCTACAGAAATTACTAAGG - Intronic
1174990368 20:55502473-55502495 ATGTCCTACACATAAGACTGTGG + Intergenic
1175586090 20:60141070-60141092 GACTCCTAAATATAGGACTAAGG - Intergenic
1178061487 21:28858029-28858051 GTCGCATAAAGATAAGACCAAGG - Intergenic
1184801192 22:46761215-46761237 GTCCCCTACAGACAACACTGAGG - Intergenic
966164938 3:177006695-177006717 ATCTTCTTCAGATAAGACTTTGG + Intergenic
969848357 4:9937313-9937335 GTCTCCTACAGAAAACCCAAGGG - Intronic
971776447 4:30972396-30972418 CTGTCCTACAGTTAAGACAAAGG + Intronic
974942904 4:68490031-68490053 GTCTCCTGCAGCTAAGATTCTGG + Intronic
977570414 4:98623126-98623148 ACCTCTTACACATAAGACTAAGG - Intronic
977658703 4:99556628-99556650 GTCTACTACAGATAAAAATGGGG + Intronic
981016245 4:139977430-139977452 GTGTCCTTCACATAAGACTAAGG + Intronic
988430945 5:31117723-31117745 GTCTCTTTCAGAGAAGGCTAGGG - Intergenic
992201658 5:74390400-74390422 GTCTCCTACTGATAAAATTAAGG - Intergenic
992344943 5:75867152-75867174 GTCTCCTTGAGAGGAGACTAAGG + Intergenic
992767457 5:80014289-80014311 GCCTCCAACAGATATGACCATGG + Intronic
994797483 5:104322212-104322234 ATATGCTACAGATAAGACTCGGG - Intergenic
1003957116 6:11174347-11174369 GCCTCCTCCAGATAAGAGTCTGG + Intergenic
1009698362 6:67141071-67141093 GTCTCATGCAAATTAGACTAAGG + Intergenic
1012175929 6:96084617-96084639 GTCTCATAGAAATTAGACTAAGG + Intronic
1012790651 6:103690267-103690289 GTCACCTCTAGAAAAGACTAGGG + Intergenic
1014536260 6:122616535-122616557 GACTCCTAAAGATAGGACAAAGG - Intronic
1021477984 7:21084484-21084506 GTCTCTGACTGATGAGACTATGG + Intergenic
1021776073 7:24056693-24056715 GTCTCTTACAGATACAGCTATGG - Intergenic
1022620417 7:31978231-31978253 ATCTCCTACAGATAAAACCTTGG + Intronic
1026280573 7:68918473-68918495 GTCTCCTGCCTCTAAGACTAAGG - Intergenic
1026472570 7:70706604-70706626 GTCTCTAACAGAAAAGCCTACGG - Intronic
1029189628 7:98762369-98762391 TTCTCTTCCAGATGAGACTAGGG + Intergenic
1031262090 7:119533747-119533769 CTCACCTCCAGATGAGACTATGG + Intergenic
1042744357 8:72090832-72090854 GTCTCCCAGAGATATGACTCAGG + Intronic
1046223991 8:111252529-111252551 GACTCCTAAAAATAAGACAAAGG - Intergenic
1052246017 9:26336116-26336138 GTCACCTACAGAGCAGACTTTGG + Intergenic
1055150494 9:72992618-72992640 GTCTCCTCCAGACAATACAATGG + Intronic
1058234880 9:102477264-102477286 GTCTTCAAGAGATGAGACTAAGG - Intergenic
1187183913 X:16966749-16966771 GACTCCAACAGAAAAGACAAAGG - Intronic
1191691783 X:63946966-63946988 GTCTCCTACAGTGAAGTCTAAGG + Intergenic
1197830279 X:130634710-130634732 GTCTCCAAGAGAGAAGACTGAGG + Intronic
1198576057 X:138011494-138011516 GTGTCCAACAGATAAAACAAGGG - Intergenic
1199944629 X:152655342-152655364 GTCTCCTAGATAGAAGACTGGGG + Exonic
1202273363 Y:23091587-23091609 GTCACTCACAGATGAGACTATGG + Intergenic
1202292663 Y:23329095-23329117 GTCACTCACAGATGAGACTATGG - Intergenic
1202426360 Y:24725331-24725353 GTCACTCACAGATGAGACTATGG + Intergenic
1202444429 Y:24944755-24944777 GTCACTCACAGATGAGACTATGG - Intergenic