ID: 1106575994

View in Genome Browser
Species Human (GRCh38)
Location 13:30976257-30976279
Sequence GCTGCTGGTGGGAAACCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 132}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106575994_1106575998 7 Left 1106575994 13:30976257-30976279 CCTGTAGGTTTCCCACCAGCAGC 0: 1
1: 0
2: 0
3: 13
4: 132
Right 1106575998 13:30976287-30976309 TGTTGTTGTTATTGCCGCTTTGG 0: 1
1: 0
2: 3
3: 36
4: 440

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106575994 Original CRISPR GCTGCTGGTGGGAAACCTAC AGG (reversed) Intergenic
903047045 1:20572568-20572590 GTGGATGGTGGGAAACTTACAGG + Intergenic
903329321 1:22589079-22589101 CCTGCTGGTGGCCAACCTGCTGG + Exonic
909040444 1:70643071-70643093 GCTGCTGGTGGGGAAGCTGAAGG - Intergenic
913128069 1:115811685-115811707 GCTGAGAGTGGGAAACCTGCTGG + Intergenic
921482027 1:215674674-215674696 GCTGCAGGTGGGAAACCAGCAGG + Exonic
921810433 1:219506391-219506413 CCTGCTGGTGAAAAACCCACTGG + Intergenic
922774374 1:228208069-228208091 GCTGCTGGTAGGCAGCCTGCTGG + Intronic
1066450584 10:35524870-35524892 GATGCTGGTGGGAAGTCCACTGG + Intronic
1070657834 10:78283377-78283399 GCTGCAGGTGGGAGGCCTGCAGG + Intergenic
1072207801 10:93220566-93220588 CCTGCTGGTGGGGACCCTGCAGG - Intergenic
1076632756 10:131861300-131861322 GCTGCTGGTCTGAAATCTGCAGG - Intergenic
1077433746 11:2528411-2528433 GCTGCTGCTGGGACACCAGCAGG - Intronic
1081383433 11:42443772-42443794 GCTGCTGGTTGGAAACCAGTGGG - Intergenic
1083228644 11:61300808-61300830 GGAGGTGGTGGCAAACCTACAGG - Exonic
1084566600 11:69932154-69932176 TCTGCTGCTGGGAAAGCCACTGG - Intergenic
1085859296 11:80213416-80213438 TCTGCTTCTGGGAAAGCTACAGG - Intergenic
1086144842 11:83540415-83540437 TCTGCTGGTGGGAGATCTATAGG + Intronic
1086147274 11:83566202-83566224 GCAGCTGGTGGAAAAACCACAGG + Intronic
1090276627 11:125424590-125424612 GCTGATGGCAGGAAACCTAATGG + Intronic
1090848555 11:130550410-130550432 GCAGCAGGTTGTAAACCTACTGG - Intergenic
1090995827 11:131864986-131865008 GCTGGAGGTGGGAGACCCACTGG - Intronic
1091147375 11:133291456-133291478 GCTGCTGGTGGGCACCCCTCAGG + Intronic
1091814658 12:3428174-3428196 TCTCCTGCTGGGAAACCTGCTGG + Intronic
1091924577 12:4334715-4334737 GCAGCTGGTGGTAAACATAGTGG + Intronic
1095390585 12:41701310-41701332 AGTGCTGGTGGGAGACCTGCTGG - Intergenic
1095716450 12:45351399-45351421 GCTTCTGGAGGAAAACCAACAGG - Intronic
1095893520 12:47257638-47257660 GCAGCTGGTGGAAAACCTTAAGG + Intergenic
1101112817 12:101502895-101502917 GCTGCAGGTGGAGAACCTACAGG - Intergenic
1101873624 12:108584203-108584225 GCAGCTGCCGGGAAACCTCCCGG + Intergenic
1103621574 12:122190226-122190248 GGTGCTGCAGGGAAACCCACTGG + Exonic
1106575994 13:30976257-30976279 GCTGCTGGTGGGAAACCTACAGG - Intergenic
1107428235 13:40315637-40315659 GCTGCTGGCAGCACACCTACAGG - Intergenic
1108342973 13:49515762-49515784 GCTGCTGGGTGGAGAACTACGGG - Intronic
1111721175 13:91947003-91947025 GCTGCTGGAGTTAAACCTCCAGG - Intronic
1113893779 13:113750045-113750067 GCTGATGGTGGGACACCTGCTGG + Intergenic
1116996015 14:51325719-51325741 GTTGCTGATGGGAAGTCTACTGG + Intergenic
1117157577 14:52956211-52956233 GCTGCTGATGGGAAAGCAAATGG + Intergenic
1119477680 14:74940444-74940466 GCTGCTGAGGAGAAACCCACAGG - Intergenic
1121159807 14:91726977-91726999 TGTGCTGGTGGGAAGCCTATAGG - Intronic
1125344510 15:38705511-38705533 GCAGATGGTGGGAAATCTAGAGG + Intergenic
1125344828 15:38708685-38708707 ACTGCTTGTGGGAAATTTACAGG - Intergenic
1126735365 15:51727287-51727309 GCTGCTGTTTGAAAACCAACTGG - Intronic
1126856745 15:52846571-52846593 GCTGGTTGTTGGAAACCTATTGG + Intergenic
1127760593 15:62135830-62135852 GCTGCTGCTGGGAAACGAAGAGG - Intergenic
1128398761 15:67255137-67255159 GCTTCTGGGGCGTAACCTACAGG - Intronic
1129066342 15:72907717-72907739 CCTACTGGTATGAAACCTACAGG - Intergenic
1129767798 15:78181282-78181304 GCTGGTGGAGGGAAACTTGCTGG + Intronic
1130212783 15:81941002-81941024 TCTGCTAATGGGAAATCTACAGG + Intergenic
1130675761 15:85950546-85950568 GCTGCTTGGGGGAAATCTCCTGG + Intergenic
1131048010 15:89328475-89328497 GCTGCTGCTGGAAAACCTCATGG + Exonic
1132809036 16:1788864-1788886 GCTGCTGGTGCGACACATCCTGG - Exonic
1133027615 16:2995535-2995557 GCTGCTGGGAGGAAGCCTCCAGG + Intergenic
1135121720 16:19771901-19771923 GCTGCTGTGGTGAAACCGACAGG + Intronic
1140457830 16:75115038-75115060 GCTGCTGGGGGGACACCCGCGGG - Intronic
1141568830 16:84921988-84922010 GCGGCTGGCGGGAGACCCACTGG - Intergenic
1142661956 17:1436763-1436785 GCTGTGGGTGGGAACCCTCCTGG + Exonic
1143003458 17:3810889-3810911 GCTGCTGGTGTAAAACCAAAAGG + Intergenic
1143449550 17:7027649-7027671 CCTGCGGGTGGGAAAGCTGCAGG + Exonic
1148506154 17:48128708-48128730 ACTCCTGGTGGGAGACCTGCGGG + Intergenic
1150046638 17:61919992-61920014 GTTGCTAGTGGGTATCCTACTGG - Intronic
1151727390 17:75892811-75892833 CCTGCTGCTGGGTAACCTCCAGG + Exonic
1158537477 18:58321260-58321282 GCTGATGGTGGGAACTCTAAAGG + Intronic
1161428133 19:4215862-4215884 GGTGCTCGTGGGAGACATACAGG + Intronic
1167326801 19:48831688-48831710 GCTGCTGGAGCTGAACCTACTGG - Exonic
928428796 2:31200975-31200997 GCTGCTTGCGGGAAACCTGTTGG + Intronic
928620632 2:33084396-33084418 GCTGCTGGTGGGAGGCGTCCTGG + Intronic
933510181 2:83231161-83231183 GGTGCTGTTGGGAAAGATACTGG - Intergenic
938369812 2:130762111-130762133 GTTTCTCGTGGGAAACCTGCAGG - Exonic
940268313 2:151863416-151863438 GCTGCTGGATAGAAACATACAGG + Intronic
941388464 2:164882025-164882047 GCTGCTGGTGGGGAATCCTCAGG + Intergenic
941759854 2:169230004-169230026 GCTGGTGCTCTGAAACCTACTGG + Intronic
943043474 2:182830228-182830250 TCTGGTGGTGGGAAACATAGGGG + Intergenic
943704170 2:191017580-191017602 GCTGCTGGTCTGAAACCAACTGG + Intronic
945685809 2:212968418-212968440 GCTGCTGGTGGGGAAACCAGTGG + Intergenic
946183211 2:217961188-217961210 GATGGTGGTGGGAAACCCTCTGG - Intronic
946880880 2:224176124-224176146 GCTGCTTGTGAGAACCCTCCAGG - Intergenic
947073681 2:226318836-226318858 GCTGCAGGTGGGGAACAAACTGG + Intergenic
947425658 2:229980852-229980874 GCTGCTGGCGGGAAACCACCTGG - Intronic
1169970232 20:11261821-11261843 CCTGCTGGTGGGAAACCCCAGGG + Intergenic
1170363614 20:15575559-15575581 GCTGGAGTAGGGAAACCTACTGG + Intronic
1173374646 20:42472416-42472438 GCTGCTGGTTGAACACATACTGG + Exonic
1173690743 20:44959424-44959446 GCTGCTGGATGGGAAGCTACTGG - Intronic
1173872738 20:46351983-46352005 GCTGCTGGTGAGAAACCCCTGGG + Intronic
1174488057 20:50873579-50873601 GCCGCTGGTGGGTAACCCACAGG - Intronic
1174837890 20:53875574-53875596 GCTGCTGTTCGGAGACCTGCAGG - Intergenic
1176099615 20:63358999-63359021 GCTGCTGGGAGGAAGCCTACTGG - Intronic
1179176303 21:39010599-39010621 GCTGTTGGAGGTAAAGCTACTGG - Intergenic
1180102484 21:45595305-45595327 GCTGTTGGTGGGAACCCTGAAGG - Intergenic
1181512361 22:23394630-23394652 GCTGCTGCTGGGCACCCTGCTGG + Intergenic
1183947463 22:41334768-41334790 GCTCATGGTGGAGAACCTACAGG - Intronic
1184942040 22:47775834-47775856 CCTGCTGGTGGGAATGCAACAGG + Intergenic
949908775 3:8882550-8882572 GCTGATGGTGGGAAACAGCCGGG - Intronic
950441800 3:13014886-13014908 GCTCCTGGGGGGACACATACTGG + Intronic
951064550 3:18248809-18248831 ACAGCTGGTGGGAATCCGACTGG + Intronic
954840982 3:53511332-53511354 GCCGCTGCTGGGAAACCTTGAGG - Intronic
955796379 3:62641610-62641632 GCTTCTGATGGGAAACCAATGGG - Intronic
956672312 3:71702814-71702836 TCTGCTGGTGAAATACCTACAGG + Intronic
960916584 3:122701516-122701538 GCTGCTGGTGGTAAACCTGGCGG - Exonic
961885016 3:130091369-130091391 GCTGAGGGTGGGAGGCCTACCGG - Exonic
962148631 3:132869173-132869195 TCTGCTGATGGGAAACCATCTGG + Intergenic
968890595 4:3366615-3366637 TCTGCTGTTGAGAAACCTTCAGG + Intronic
973573854 4:52266309-52266331 GCTGCTGGTGGAAAAAATGCAGG - Intergenic
974598152 4:64039471-64039493 GCTTCTGGTGGAACACCTAATGG - Intergenic
975666615 4:76740324-76740346 GCCGCGGGTAGGAAACCTGCCGG - Exonic
976518472 4:85999102-85999124 GGTGCTTGTGGGAAACTTCCAGG - Intronic
982235892 4:153250742-153250764 GCTCCCTGTGGGAAACATACTGG + Intronic
983904335 4:173168871-173168893 GCTGGTGGTGGGAAGCTTCCTGG + Exonic
984467232 4:180116138-180116160 GCTGCTGGTGGGAATGCCACAGG + Intergenic
985759678 5:1740169-1740191 GCTTTTGGTGGGAAAGCTTCTGG + Intergenic
987830662 5:23090507-23090529 GCTGCTGTTGGGTAACCTCTAGG - Intergenic
993427111 5:87780234-87780256 GCTGTTGGTGGGAAACTAATAGG - Intergenic
999652681 5:153783022-153783044 GCTGGAGGTGGGAGACCTGCAGG + Intronic
1000342586 5:160289167-160289189 GCTGGCGGTGGGAAGCCCACAGG - Intronic
1000718366 5:164675991-164676013 GCTCCTGCTGGGAAAGCTGCAGG - Intergenic
1002937278 6:1684252-1684274 GTTGCTGGTGGGAATGCAACAGG + Intronic
1003171530 6:3725039-3725061 GCTGTGGGTGGGAAAGCTATGGG + Intronic
1003652428 6:7973647-7973669 TCTGCAGGTGGGAAGCCTAAGGG + Intronic
1007079062 6:39085985-39086007 GCTGCTGGTGGGACACTTGAGGG - Exonic
1011427729 6:87248942-87248964 GTTGCTAGTGGCAATCCTACTGG + Intronic
1012147219 6:95700194-95700216 GCTCCTTGTGGGAAACCTTGAGG - Intergenic
1012172659 6:96038606-96038628 GCAGCTGGTGGGAAACATATTGG - Intronic
1013304959 6:108839212-108839234 GCTCCTGGCGGGAGACCCACAGG + Intergenic
1016531018 6:145058250-145058272 GATGCTGGTGGGAGCCCTGCAGG - Intergenic
1021553145 7:21893281-21893303 ACTGCTGGTGGGAAAGTAACTGG - Intronic
1029371832 7:100155284-100155306 GCTGCTGGTGGGAGAAGGACTGG + Exonic
1029489335 7:100861805-100861827 GCTCCTGGTGGGGAACCCCCGGG + Exonic
1035420588 7:158726464-158726486 GCAGCAGGTGGGAGACCAACTGG - Intergenic
1036091310 8:5668680-5668702 GCTGCTGGAGCTAAACCTGCAGG + Intergenic
1038089508 8:24237434-24237456 TCTCCTGTTGGGAAACCTGCTGG - Intergenic
1039896782 8:41722394-41722416 ACTGCTCGTGGGAAACCTCCTGG + Intronic
1040388841 8:46932858-46932880 GATCCTGGTGGGCACCCTACTGG - Intergenic
1041142939 8:54842469-54842491 GCTCCTGGTGGAAACCCCACAGG - Intergenic
1042597878 8:70469013-70469035 ACTGCTTGTTGTAAACCTACAGG - Intergenic
1043358469 8:79441450-79441472 GCTGCTGATGGGAAACAGATCGG + Intergenic
1049647276 8:143741108-143741130 GCTCCTGGTGGGAAACCAAGAGG + Intergenic
1051001439 9:12287291-12287313 GCTTCTTGGGGGAAACCTACAGG + Intergenic
1051271608 9:15360776-15360798 GTTGCTGGTGGGAGTCCAACTGG - Intergenic
1053062633 9:35043953-35043975 GATGCTGGTGGGACACATTCAGG - Exonic
1053222310 9:36322701-36322723 GCTGTTGGTGCCAAACCTGCAGG + Intergenic
1058912537 9:109534193-109534215 GCTGCTGATGTGAAGCCTCCCGG + Intergenic
1061284026 9:129612223-129612245 GCTTGTGGTGTGACACCTACTGG + Exonic
1061582308 9:131545655-131545677 GGTGCTGGTGGGACAGGTACTGG + Intergenic
1061733243 9:132633264-132633286 GCTGCTGGTGGGAATCCCTATGG + Intronic
1062117962 9:134819173-134819195 GCTGGTGGTGGGGAACCTGAGGG + Intronic
1190509706 X:51162797-51162819 GCTGCTAAGGGGAAACCTGCTGG + Intergenic
1197967710 X:132082649-132082671 TCAGCAGGTGTGAAACCTACAGG - Intronic