ID: 1106578999

View in Genome Browser
Species Human (GRCh38)
Location 13:31001533-31001555
Sequence CTGCTTTCAGTGTTGAACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106578995_1106578999 -2 Left 1106578995 13:31001512-31001534 CCCGCTCCCATTCTGAAGGAGCT No data
Right 1106578999 13:31001533-31001555 CTGCTTTCAGTGTTGAACAGAGG No data
1106578998_1106578999 -9 Left 1106578998 13:31001519-31001541 CCATTCTGAAGGAGCTGCTTTCA No data
Right 1106578999 13:31001533-31001555 CTGCTTTCAGTGTTGAACAGAGG No data
1106578993_1106578999 8 Left 1106578993 13:31001502-31001524 CCTCACTGTGCCCGCTCCCATTC No data
Right 1106578999 13:31001533-31001555 CTGCTTTCAGTGTTGAACAGAGG No data
1106578992_1106578999 9 Left 1106578992 13:31001501-31001523 CCCTCACTGTGCCCGCTCCCATT No data
Right 1106578999 13:31001533-31001555 CTGCTTTCAGTGTTGAACAGAGG No data
1106578996_1106578999 -3 Left 1106578996 13:31001513-31001535 CCGCTCCCATTCTGAAGGAGCTG No data
Right 1106578999 13:31001533-31001555 CTGCTTTCAGTGTTGAACAGAGG No data
1106578997_1106578999 -8 Left 1106578997 13:31001518-31001540 CCCATTCTGAAGGAGCTGCTTTC No data
Right 1106578999 13:31001533-31001555 CTGCTTTCAGTGTTGAACAGAGG No data
1106578991_1106578999 20 Left 1106578991 13:31001490-31001512 CCAGCAGTGCTCCCTCACTGTGC No data
Right 1106578999 13:31001533-31001555 CTGCTTTCAGTGTTGAACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106578999 Original CRISPR CTGCTTTCAGTGTTGAACAG AGG Intergenic
No off target data available for this crispr