ID: 1106580168

View in Genome Browser
Species Human (GRCh38)
Location 13:31010864-31010886
Sequence CCTTCTCCAGACTCTGCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106580168_1106580177 27 Left 1106580168 13:31010864-31010886 CCTCAAGCAGAGTCTGGAGAAGG No data
Right 1106580177 13:31010914-31010936 GCTCTCCTGTGCTGGGATCCTGG No data
1106580168_1106580175 19 Left 1106580168 13:31010864-31010886 CCTCAAGCAGAGTCTGGAGAAGG No data
Right 1106580175 13:31010906-31010928 GCAGCGTGGCTCTCCTGTGCTGG No data
1106580168_1106580176 20 Left 1106580168 13:31010864-31010886 CCTCAAGCAGAGTCTGGAGAAGG No data
Right 1106580176 13:31010907-31010929 CAGCGTGGCTCTCCTGTGCTGGG No data
1106580168_1106580173 5 Left 1106580168 13:31010864-31010886 CCTCAAGCAGAGTCTGGAGAAGG No data
Right 1106580173 13:31010892-31010914 TGAGTGACCAGTGAGCAGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106580168 Original CRISPR CCTTCTCCAGACTCTGCTTG AGG (reversed) Intergenic
No off target data available for this crispr