ID: 1106582027

View in Genome Browser
Species Human (GRCh38)
Location 13:31027088-31027110
Sequence CTGGAGAAGAAGGAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106582027_1106582034 25 Left 1106582027 13:31027088-31027110 CCCTCCTCCTCCTTCTTCTCCAG No data
Right 1106582034 13:31027136-31027158 CTCAACAATTGCAGTGAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106582027 Original CRISPR CTGGAGAAGAAGGAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr