ID: 1106587577

View in Genome Browser
Species Human (GRCh38)
Location 13:31070588-31070610
Sequence GCTCAGAGCAGACTTCTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106587577_1106587585 7 Left 1106587577 13:31070588-31070610 CCTGCTAGAAGTCTGCTCTGAGC No data
Right 1106587585 13:31070618-31070640 AGCTCTCTGGTTTATGGCCTAGG No data
1106587577_1106587582 1 Left 1106587577 13:31070588-31070610 CCTGCTAGAAGTCTGCTCTGAGC No data
Right 1106587582 13:31070612-31070634 CCCTCCAGCTCTCTGGTTTATGG No data
1106587577_1106587578 -6 Left 1106587577 13:31070588-31070610 CCTGCTAGAAGTCTGCTCTGAGC No data
Right 1106587578 13:31070605-31070627 CTGAGCCCCCTCCAGCTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106587577 Original CRISPR GCTCAGAGCAGACTTCTAGC AGG (reversed) Intergenic
No off target data available for this crispr