ID: 1106587740

View in Genome Browser
Species Human (GRCh38)
Location 13:31072012-31072034
Sequence CAGCGGTGCTGGAGAGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106587740_1106587746 14 Left 1106587740 13:31072012-31072034 CCCTCTTCTCTCCAGCACCGCTG No data
Right 1106587746 13:31072049-31072071 CATCATGATCTTCTCTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106587740 Original CRISPR CAGCGGTGCTGGAGAGAAGA GGG (reversed) Intergenic
No off target data available for this crispr