ID: 1106592441

View in Genome Browser
Species Human (GRCh38)
Location 13:31109488-31109510
Sequence TGCTGTGCATGGAAGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106592441_1106592454 25 Left 1106592441 13:31109488-31109510 CCCTCTCCCTTCCATGCACAGCA No data
Right 1106592454 13:31109536-31109558 TGGCATTTTGTTCCTTCCTCTGG No data
1106592441_1106592455 26 Left 1106592441 13:31109488-31109510 CCCTCTCCCTTCCATGCACAGCA No data
Right 1106592455 13:31109537-31109559 GGCATTTTGTTCCTTCCTCTGGG No data
1106592441_1106592456 27 Left 1106592441 13:31109488-31109510 CCCTCTCCCTTCCATGCACAGCA No data
Right 1106592456 13:31109538-31109560 GCATTTTGTTCCTTCCTCTGGGG No data
1106592441_1106592447 5 Left 1106592441 13:31109488-31109510 CCCTCTCCCTTCCATGCACAGCA No data
Right 1106592447 13:31109516-31109538 CCCCCTCCTGTGCATGCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106592441 Original CRISPR TGCTGTGCATGGAAGGGAGA GGG (reversed) Intergenic
No off target data available for this crispr