ID: 1106593761

View in Genome Browser
Species Human (GRCh38)
Location 13:31120007-31120029
Sequence CTTGATCTACCGAGGGTACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106593761_1106593765 0 Left 1106593761 13:31120007-31120029 CCTGGTACCCTCGGTAGATCAAG No data
Right 1106593765 13:31120030-31120052 AGCATTCAGATCTGGTCTCAAGG No data
1106593761_1106593764 -8 Left 1106593761 13:31120007-31120029 CCTGGTACCCTCGGTAGATCAAG No data
Right 1106593764 13:31120022-31120044 AGATCAAGAGCATTCAGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106593761 Original CRISPR CTTGATCTACCGAGGGTACC AGG (reversed) Intergenic
No off target data available for this crispr