ID: 1106595818

View in Genome Browser
Species Human (GRCh38)
Location 13:31135470-31135492
Sequence GCAGCTAGAAATTATAAAGT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 223}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106595816_1106595818 27 Left 1106595816 13:31135420-31135442 CCAAAGAAACATATTAACTGCAT 0: 1
1: 0
2: 2
3: 22
4: 318
Right 1106595818 13:31135470-31135492 GCAGCTAGAAATTATAAAGTAGG 0: 1
1: 0
2: 4
3: 18
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106595818 Original CRISPR GCAGCTAGAAATTATAAAGT AGG Exonic
901091592 1:6645286-6645308 GCAGCCAGTAATTAAAAAGTGGG + Intronic
902355971 1:15900706-15900728 GCAGCTTGAAATTAGCATGTTGG + Intronic
905465562 1:38150644-38150666 GCTGCTAGTGATTATAAAGCAGG + Intergenic
906738674 1:48158874-48158896 ACAATTAGAAGTTATAAAGTAGG - Intergenic
908625378 1:66034875-66034897 GCAGACAGAAATAACAAAGTTGG - Intronic
908649137 1:66313011-66313033 ACTGCTAGAATTTAAAAAGTGGG - Intronic
909197331 1:72644367-72644389 AAAGCTAGAAATGACAAAGTGGG - Intergenic
910494967 1:87816690-87816712 GCAGCAGGTAATTATGAAGTAGG + Intergenic
912007798 1:104925954-104925976 GCATATAGAAATTATAAAAGTGG - Intergenic
912880455 1:113407134-113407156 GCCACTGGAAAGTATAAAGTTGG + Intronic
913381132 1:118211334-118211356 GCAGCTGGAAATGAAACAGTAGG + Intergenic
914453461 1:147813768-147813790 GCAGCTATAAATGACAGAGTAGG + Intergenic
914812500 1:151039104-151039126 GCAGTTAGAACTAATAAGGTGGG + Intronic
914854001 1:151336866-151336888 CCAGCTAGAATGTTTAAAGTTGG + Intergenic
915073881 1:153293466-153293488 GCAGCTAAAAAAAAAAAAGTGGG + Intergenic
915503330 1:156335725-156335747 GCATCTAGACTTTATAGAGTAGG - Intronic
917163509 1:172084629-172084651 GTAGCTATAAATTTTAAAGTTGG + Intronic
917588092 1:176448348-176448370 GTTGCTAGAAATAATAAAGTTGG + Intergenic
918705506 1:187656783-187656805 GCACTTAGAAACTATAAACTGGG - Intergenic
919292463 1:195650104-195650126 GCAGCTACAACATGTAAAGTAGG + Intergenic
920679260 1:208060214-208060236 TCAGCTGGAAATTAGAAAATAGG - Intronic
922441552 1:225659269-225659291 CCAGCTAGATTTTATAAAATAGG - Intergenic
923936552 1:238766937-238766959 GAAACTAGAAATTCTAAACTAGG + Intergenic
1063934890 10:11066995-11067017 ACAGGTAGAAATTATAATGAGGG + Intronic
1064376198 10:14798577-14798599 GCAGCTACTATTTAAAAAGTCGG + Intergenic
1066002228 10:31115263-31115285 GCATTTAAAAAATATAAAGTAGG - Intergenic
1067332706 10:45336697-45336719 GCAGCTAGAATATGAAAAGTTGG + Intergenic
1067491588 10:46711220-46711242 ATAACTAGCAATTATAAAGTTGG + Intergenic
1067603074 10:47629158-47629180 ATAACTAGCAATTATAAAGTTGG - Intergenic
1067754029 10:48991172-48991194 GCTGCCAGAAAATATAAAGCAGG - Intergenic
1068236035 10:54233448-54233470 GCAATTAGAAATTATAATGAAGG - Intronic
1068332768 10:55593087-55593109 ATAACTAGCAATTATAAAGTTGG - Intronic
1069783545 10:70973410-70973432 GAAACTAGAAATAATAAAATGGG + Intergenic
1072773693 10:98166965-98166987 GGTAGTAGAAATTATAAAGTAGG - Intronic
1074332940 10:112537808-112537830 GCAGATAGAAATTTTAAAACAGG - Intronic
1075123448 10:119681164-119681186 GAAGCAACAAAGTATAAAGTGGG - Intergenic
1079594123 11:22220576-22220598 GCAGTTAAATATTATAAAGCAGG - Intronic
1079698730 11:23517871-23517893 CTAGCTAGAAATTTAAAAGTGGG - Intergenic
1081380687 11:42410907-42410929 GCAGATATAAAATATAATGTTGG + Intergenic
1082251775 11:49990325-49990347 ACAGATAGAAATTATAAAAAAGG - Intergenic
1082590400 11:55000885-55000907 TCAGCTAAAAATTACAAAGAAGG + Intergenic
1084990962 11:72925362-72925384 CCAGCTGGAATTTTTAAAGTAGG - Intronic
1087525126 11:99299366-99299388 CCAAATAAAAATTATAAAGTTGG + Intronic
1087566056 11:99859510-99859532 GAAACTAGAAACTATTAAGTGGG - Intronic
1088285868 11:108187041-108187063 GCAGTTGGTCATTATAAAGTAGG - Intronic
1088420555 11:109640963-109640985 TCAGTTAGAATTTATAAATTTGG + Intergenic
1088603378 11:111504468-111504490 GCAGATAGAAAATACAAATTAGG - Intronic
1089231260 11:116978807-116978829 GCAGTTAGAAATAATAAATACGG - Intronic
1092589430 12:9937236-9937258 CCATTTAGAAATTATAAAGAAGG + Intergenic
1093050155 12:14495124-14495146 GCTGCCAGAAAATATAAAGCAGG - Intronic
1095646878 12:44558250-44558272 GCAGCTAGAAATAGTGAAATTGG - Intronic
1095764978 12:45885093-45885115 GCAACTAGATAAAATAAAGTTGG + Intronic
1097348980 12:58526830-58526852 GCTGCAAGAAAAAATAAAGTGGG + Intergenic
1097498110 12:60368465-60368487 ACAGAAAAAAATTATAAAGTAGG + Intergenic
1099189632 12:79549011-79549033 GCTGCTAGAAATCTTAAACTCGG + Intergenic
1100104537 12:91153531-91153553 AAAGATAGTAATTATAAAGTGGG + Intronic
1100858728 12:98781876-98781898 GCAGCTCTAAATGATAAAGTAGG - Intronic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1103812426 12:123626290-123626312 GCAGCTATTAATTAAGAAGTAGG + Intronic
1104642609 12:130477045-130477067 GCCTCTAGAAATTACAAAATTGG + Intronic
1106595818 13:31135470-31135492 GCAGCTAGAAATTATAAAGTAGG + Exonic
1111566306 13:90021306-90021328 GCTGAAAGACATTATAAAGTTGG + Intergenic
1111680855 13:91439473-91439495 GCAGATTGAAAATATAAACTGGG - Intronic
1112767803 13:102763859-102763881 GCAGATAGAAAATTGAAAGTTGG + Intergenic
1113264346 13:108600880-108600902 CCTGCTGGAAAATATAAAGTTGG - Intronic
1113982275 13:114286500-114286522 GGATCTAGACATTAAAAAGTAGG - Exonic
1116227898 14:42176032-42176054 GCAGAAAGAAATTATAAAAATGG + Intergenic
1117471662 14:56052103-56052125 GTATCTATTAATTATAAAGTTGG + Intergenic
1118891447 14:69912986-69913008 GAAGCTTCAAATTAGAAAGTGGG + Intronic
1119099796 14:71869272-71869294 GCAGCTAGAGATGAGCAAGTAGG + Intergenic
1119384453 14:74248716-74248738 ACAGAGAGAAATTATCAAGTTGG + Intronic
1120273237 14:82341053-82341075 GAAGCTAGATATTAGAAAGCAGG + Intergenic
1124889898 15:33723117-33723139 GCAGCTGGAAATCACAAAGTGGG + Intronic
1125421966 15:39512857-39512879 GCAGCAAGAGATCATAGAGTGGG - Intergenic
1126842972 15:52734995-52735017 GCAACAAAAAATTATAAATTTGG + Intergenic
1128186161 15:65644982-65645004 GCAGCTAGGACTGAGAAAGTGGG + Intronic
1131759718 15:95608737-95608759 TTAGTTAGAAATTAGAAAGTCGG + Intergenic
1131769746 15:95724185-95724207 GTAATTAAAAATTATAAAGTGGG - Intergenic
1132035238 15:98478247-98478269 GCAGTAAAAAATTTTAAAGTTGG + Intronic
1137669107 16:50269105-50269127 GTAGCTATAAATTGTAGAGTGGG - Intronic
1138034409 16:53589901-53589923 CAAACTAGAACTTATAAAGTGGG - Intergenic
1138602034 16:58061624-58061646 GCAGCTAAAAACAATAAGGTAGG - Intergenic
1146034754 17:29396672-29396694 GCAGCTACCAATAATAAAATTGG + Intronic
1154041442 18:10859944-10859966 GCAGCTAGGAAGTTTAAAGTGGG + Intronic
1156096472 18:33538910-33538932 GCAACTAGAAAATATCATGTGGG + Intergenic
1156919731 18:42506610-42506632 ACAGCTAGAGAATATAAACTTGG + Intergenic
1160191422 18:76717279-76717301 GCTGCTAGCAAATATAAAGCAGG - Intergenic
1167972266 19:53195673-53195695 GAAGCCAGAAATAAAAAAGTAGG + Intergenic
930061653 2:47294564-47294586 GCAGCCAGAGAATATAAAGCAGG + Intergenic
930252126 2:49046175-49046197 GCATTTTGAAATTATAAAATAGG + Intronic
930682827 2:54275470-54275492 GAAGCTAGAAATAGTCAAGTGGG - Intronic
932929737 2:76020300-76020322 CCTGCTAGAAATTGTAAATTGGG + Intergenic
933221675 2:79696970-79696992 AGATCTAAAAATTATAAAGTTGG + Intronic
934129051 2:88929055-88929077 GCAGTTAAAAATTTTAAGGTGGG - Intergenic
935164417 2:100557541-100557563 TTAGCTACAAATAATAAAGTGGG + Intergenic
938028531 2:127971588-127971610 GAAGATAGAAATGAGAAAGTGGG - Intronic
938594747 2:132776598-132776620 GCAGCAAGAAAATGGAAAGTGGG + Intronic
940171769 2:150836269-150836291 GCTGCTAGGAAATATAAAGCAGG - Intergenic
940415232 2:153411985-153412007 GCTGCCAGAAAATATAAAGCAGG + Intergenic
941311393 2:163936637-163936659 GATGCTAGAAATTATTCAGTAGG - Intergenic
942456033 2:176139089-176139111 GAAGCTCGAAATTATAAATGTGG + Intergenic
942515272 2:176746138-176746160 GCTGCTAGAAATGCTAAAATAGG - Intergenic
943486414 2:188490031-188490053 GCTGCTAGAAATTATTGAATAGG + Intronic
944022303 2:195120794-195120816 GGAGCTAAAAAATATAAAATAGG - Intergenic
944037572 2:195314060-195314082 GCAGCTGTAAATTATAAGATTGG + Intergenic
944807364 2:203295645-203295667 TCATTTAGAAATAATAAAGTAGG + Intronic
944888335 2:204088632-204088654 GCACCTGGAAAAAATAAAGTTGG - Intergenic
945323295 2:208452537-208452559 GAAGCTAGAGCTTATAAATTAGG + Intronic
945613542 2:212036949-212036971 GCAGCTAGATTTTATCAACTTGG + Intronic
945662459 2:212703044-212703066 GCACATAGAAAATATAAACTTGG + Intergenic
945749114 2:213757993-213758015 ACAGCTAGACATTAAAAAGTAGG + Intronic
945855359 2:215062803-215062825 ACAGGTAGAAATTATAAAGTAGG - Intronic
947064418 2:226205945-226205967 GCAGGTAGAAACTATAAACAAGG - Intergenic
947286854 2:228526774-228526796 AAACCTAGAAATTACAAAGTTGG - Intergenic
947582808 2:231332193-231332215 GCATGCAGAAATTAAAAAGTGGG - Intronic
948328577 2:237147021-237147043 GTACATAGAAATTATAGAGTTGG + Intergenic
1170273383 20:14554061-14554083 GCAGCTAGCAAATATTAAGCTGG - Intronic
1170639443 20:18138427-18138449 GCCGCTAGAAAATAGAAGGTGGG + Intronic
1172817174 20:37696879-37696901 GCTACTAGAAAATGTAAAGTGGG + Intronic
1172936751 20:38625930-38625952 ACAGATAAAAATTATAAAGGTGG + Intronic
1175561864 20:59937882-59937904 GAAGGCAGAAAGTATAAAGTTGG + Exonic
1177633015 21:23751102-23751124 GCAGTTAAAAACTATAAACTGGG + Intergenic
1184104664 22:42360359-42360381 TGAGCTAGAAATCACAAAGTGGG - Intergenic
949185708 3:1189115-1189137 GTAGCTAGAATTGATACAGTAGG + Intronic
949460843 3:4291806-4291828 GCAGCGAGAGATTATATAGTTGG - Intronic
949641024 3:6036151-6036173 GCAGCCAGGAAGTTTAAAGTGGG - Intergenic
951646076 3:24892424-24892446 GCAGATAGAACTTATGAAGGTGG + Intergenic
951741079 3:25924024-25924046 GGAGCCAAAAATTATAAAGGAGG + Intergenic
952165933 3:30748753-30748775 GCAGCTAGAATTTTTAACCTGGG + Intronic
953812211 3:46122958-46122980 GCTGCCAGAAAATATAAAGCAGG + Intergenic
953820824 3:46206116-46206138 TAAGATAGAAATTATAAAGTAGG - Intronic
954722057 3:52572971-52572993 GCATCTAGTAATCACAAAGTGGG - Intronic
956987645 3:74721463-74721485 GAAGATAGAAATTACAAAGAGGG - Intergenic
957617496 3:82550075-82550097 CCAGGTTGAAATTATAAATTTGG - Intergenic
959749213 3:109813229-109813251 GCAGATAGAAACCATATAGTAGG - Intergenic
960777974 3:121282865-121282887 GCACTCAGACATTATAAAGTAGG + Intronic
962443163 3:135441430-135441452 GCAGCTAAAAAGCATAAATTTGG - Intergenic
963078900 3:141372977-141372999 GCAGCTAGAAATTAGAAATCAGG - Intronic
963960289 3:151302461-151302483 GATGCTAGATACTATAAAGTAGG - Intronic
966603316 3:181796700-181796722 GCAGGCAGAAATAAAAAAGTAGG - Intergenic
969237437 4:5875812-5875834 GCAGTAAGAAACTATAAGGTTGG - Intronic
969489176 4:7489320-7489342 GCAGCCACAAATTAGGAAGTGGG - Intronic
970393833 4:15645040-15645062 GCAGGCAGAAATTTTAAAGAGGG + Intronic
970694205 4:18657297-18657319 TAAGCTATAAGTTATAAAGTGGG - Intergenic
971700530 4:29968285-29968307 GTATCTAAAAATTATAAAATAGG + Intergenic
971831421 4:31701174-31701196 GCAGCTAGAAATTGGAAGGAAGG + Intergenic
972218874 4:36930142-36930164 GCAGCAGAAAATTCTAAAGTGGG - Intergenic
973048067 4:45561061-45561083 GCTGCTAGAAAATCTAGAGTTGG + Intergenic
973126134 4:46587149-46587171 GCAGCTAAATATTTTAAATTGGG - Intergenic
973132634 4:46667001-46667023 GGAGTTTGAAATTATAAAGGAGG - Intergenic
974431923 4:61809570-61809592 GCAGCTAGCAATTTTAAATAGGG - Intronic
975860037 4:78667406-78667428 GCAGCTAGAAAGTATTAAGTGGG - Intergenic
976398015 4:84578458-84578480 GTAGGTAGAAATTATGAAATGGG - Intergenic
979966515 4:127083192-127083214 AGAGCTAGCAATTATAAAGCTGG + Intergenic
980976568 4:139616766-139616788 GCAGCAACAAAGTATAATGTTGG - Intergenic
981942873 4:150303970-150303992 TAAGCTAGAAATTCTAAAGATGG - Intronic
982075828 4:151736347-151736369 TCAGCTAGAAAATATATAATTGG - Intronic
983853438 4:172612165-172612187 GCAGGAAGAATTTTTAAAGTTGG + Intronic
984744905 4:183205533-183205555 GATGCTAGACATTATAAAGTTGG + Intronic
989307184 5:39972096-39972118 GCTGATAGAAAATATAAAGCAGG - Intergenic
989373686 5:40736814-40736836 GCAGATAGAAATGATAAAGTTGG + Intronic
990763106 5:59152406-59152428 GCAGGTAGAAACAATATAGTAGG - Intronic
991524127 5:67537520-67537542 GAAGCGAGAAATTATAAATATGG + Intergenic
992366054 5:76090932-76090954 GGAGCTTGAAATGACAAAGTGGG - Intronic
992541709 5:77771875-77771897 GCAACTAGAAATTATATTCTAGG - Intronic
992750921 5:79859818-79859840 TCTGCCAGAAATTCTAAAGTTGG + Intergenic
993875602 5:93303245-93303267 GCAGGTAGAAATTAGCACGTGGG + Intergenic
994181755 5:96775392-96775414 TTAGTTAGAAATTGTAAAGTAGG + Intronic
994193816 5:96899781-96899803 GCAGCATGAAATAATAAAATAGG + Intronic
994790717 5:104223152-104223174 GCAGCTAGGAATAATGAGGTAGG + Intergenic
996128977 5:119758092-119758114 GCAGTTAGAAGTTAGAAAATTGG + Intergenic
996331266 5:122331648-122331670 GCAGCTACGAACTAGAAAGTGGG - Intronic
996651505 5:125882581-125882603 GCAGATAGGAAATATTAAGTTGG + Intergenic
997867768 5:137479882-137479904 GCATCAAGAAATTATATAGTAGG + Intronic
998715199 5:144875608-144875630 TCAGGTAAAAACTATAAAGTTGG + Intergenic
999055412 5:148570229-148570251 GCATCTAGATATGATTAAGTTGG - Intronic
999593018 5:153169922-153169944 GCAATTAGAAATTAGAAAGAGGG + Intergenic
1000670474 5:164056265-164056287 GCATCTAGCACTTAAAAAGTAGG - Intergenic
1002330684 5:178438214-178438236 TCAGCTTGATATTGTAAAGTTGG - Intronic
1002761496 6:205887-205909 TCAGCTAGAAATTAAGCAGTAGG + Intergenic
1004706043 6:18124795-18124817 GTAGTCAGAAATTATTAAGTTGG - Intergenic
1005142402 6:22648233-22648255 TCAGCAAGAAAATAGAAAGTTGG - Intergenic
1007302082 6:40875159-40875181 ACAGAGAGAAATTATAAAATAGG - Intergenic
1007861799 6:44917906-44917928 ACCGATAGAAATTTTAAAGTAGG - Intronic
1008246961 6:49187894-49187916 TCAGCTAGAGATTATACAGCAGG - Intergenic
1009713533 6:67356264-67356286 GAAGCTAGAAACTGAAAAGTAGG + Intergenic
1010656502 6:78517971-78517993 GGAGATAGAAACTACAAAGTGGG + Intergenic
1011368321 6:86605118-86605140 GCTGCTAAAAAGGATAAAGTCGG - Intergenic
1012091656 6:94905020-94905042 ACAGCAAGAAGTTAAAAAGTAGG + Intergenic
1012204579 6:96444619-96444641 GCAGCTAAAAATGACAAAGAGGG + Intergenic
1012384680 6:98665913-98665935 ATATCTAGAAATTATAAAGGTGG + Intergenic
1013063421 6:106660035-106660057 GCAGCTAGAATTTGCAAAGCAGG - Intronic
1013985340 6:116185620-116185642 GCAGTTAGAAAAGACAAAGTGGG - Intronic
1014417307 6:121197926-121197948 GCTGCTAGAGAATATAAAGCAGG + Intronic
1015668370 6:135657922-135657944 CCAACTAGAGATTATAAAATAGG - Intergenic
1016226049 6:141739554-141739576 GCAGCTTCCAATTATGAAGTGGG + Intergenic
1016493548 6:144633973-144633995 GCAGCTAGACATTTAAAAGCAGG - Intronic
1019199631 6:170303995-170304017 GAAGCTAGGACTTATACAGTAGG - Intronic
1021348103 7:19552778-19552800 ACAGCTAGAAAACAGAAAGTTGG - Intergenic
1021784496 7:24138545-24138567 GCAGCTGCAAATTCTAAACTGGG + Intergenic
1022240764 7:28510524-28510546 GCAGCTAGAAGTTTTAAAGGTGG - Intronic
1023706126 7:42943536-42943558 GCTGCTGGGAATTATCAAGTAGG + Intronic
1024871911 7:53973389-53973411 GCAGAAAGAAATTATAAAAGAGG - Intergenic
1028890531 7:95983321-95983343 GCTGCTAGAAACTATGAGGTGGG + Intronic
1031225262 7:119028965-119028987 GCAGGTAGCAAATATAATGTGGG - Intergenic
1032571745 7:133007716-133007738 GAAGCTAAAAATCAGAAAGTTGG - Intronic
1033533607 7:142290824-142290846 GGAGCTACAAGATATAAAGTGGG - Intergenic
1034288359 7:149906731-149906753 GCAGCTAGAAAATATAACAGTGG - Intergenic
1034662773 7:152786249-152786271 GCAGCTAGAAAATATAACAGTGG + Intronic
1034912739 7:155010754-155010776 GAAGCTAGAAATTAAGATGTCGG + Intergenic
1037413651 8:18624167-18624189 GCAGTTGGCAATAATAAAGTTGG - Intronic
1037486202 8:19349478-19349500 GCAGCTGTACATTATGAAGTTGG - Intronic
1038356288 8:26832113-26832135 GCAGCGAGAAATGTTGAAGTTGG + Intronic
1040921726 8:52628073-52628095 GAATGTAGAAAATATAAAGTAGG + Exonic
1041299837 8:56399531-56399553 ACTTCTAGCAATTATAAAGTGGG - Intergenic
1041544298 8:59024589-59024611 GCAGCAGCAAATTATAAAGAGGG - Intronic
1042374121 8:68029174-68029196 GGAGCTTGAAATTATTGAGTTGG + Intronic
1042400535 8:68341162-68341184 CCATCTACAAATTAGAAAGTGGG - Intronic
1042728826 8:71908631-71908653 ACAGTTAGAAAAGATAAAGTGGG - Intronic
1042860833 8:73311916-73311938 GCAACTAGAATATTTAAAGTTGG + Intronic
1043151790 8:76727010-76727032 TGAGCTAGAAATTATGCAGTAGG - Intronic
1045730728 8:105237419-105237441 TCAGAGAGAAATTAGAAAGTAGG - Intronic
1046586220 8:116151229-116151251 GCTGCCAGCAAATATAAAGTAGG - Intergenic
1047132749 8:122039188-122039210 GCCACTAGAAATTATCTAGTAGG + Intergenic
1047470868 8:125170706-125170728 GTAGGTAGAAATAATAAGGTTGG - Intronic
1047668621 8:127120233-127120255 GCACATAGAAATAATAAAATGGG + Intergenic
1048705381 8:137147715-137147737 GAAGGTAGAAATGACAAAGTTGG - Intergenic
1051643728 9:19247931-19247953 GCAGCAAGAAATTATAATATTGG - Intronic
1051710033 9:19922076-19922098 GCAGCTAGAGAAAATAAAGTTGG + Intergenic
1055864476 9:80796502-80796524 GAATCCAGAAATTATAGAGTTGG + Intergenic
1056239922 9:84634883-84634905 TCAGCAAAAAATTATAATGTTGG + Intergenic
1056313922 9:85370415-85370437 GCTGCTAGCAAATATAAAGCAGG - Intergenic
1057336844 9:94162312-94162334 GTAGCTAGAAATCAGAAAGCGGG + Intergenic
1057679645 9:97167326-97167348 GCAAAAAAAAATTATAAAGTTGG + Intergenic
1188046883 X:25435673-25435695 ACAGCTAGAAAGTGGAAAGTGGG - Intergenic
1188212355 X:27441286-27441308 TGAGATAGAATTTATAAAGTTGG - Intergenic
1188513247 X:30959005-30959027 GGTACTAGAAATTATAAAGGTGG - Intronic
1188775471 X:34213147-34213169 GCACCTTCAAATTATAAAATGGG + Intergenic
1190419566 X:50215859-50215881 GCAGGTGGAAATTAAAAAGTGGG - Intronic
1191015403 X:55804669-55804691 GCATCTAGAAAGTGTAAAGTTGG - Intergenic
1193433315 X:81438990-81439012 GCAGCCAGCAAATATAAAGCAGG - Intergenic
1194630472 X:96276534-96276556 GCAGCTAAAAAATACAAAGAGGG + Intergenic
1196564201 X:117186003-117186025 GCAGTAAGAAAAAATAAAGTAGG + Intergenic
1196627303 X:117891108-117891130 GCGGCAAGAAGTCATAAAGTTGG - Intergenic
1199024685 X:142922243-142922265 GCTGCTAGAAAATATAAAGTAGG + Intergenic
1201497059 Y:14599438-14599460 GCTGCCAGAAATTATAAAGCAGG - Intronic