ID: 1106597022

View in Genome Browser
Species Human (GRCh38)
Location 13:31152922-31152944
Sequence CCTTCTTTACAGATGCTGAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 167}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106597022 Original CRISPR CCTTCTTTACAGATGCTGAG AGG (reversed) Exonic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
905699028 1:39998104-39998126 CCTGCTTTAGAGATGATGAAGGG + Intergenic
906042394 1:42798170-42798192 TCTTCTTTCCAGATGCTCTGTGG + Intergenic
908646826 1:66287515-66287537 CCTGCTTTAAAGGAGCTGAGAGG + Intronic
908669124 1:66526251-66526273 CCTTCTGGACAGTTGCTGACAGG + Intergenic
911268297 1:95770152-95770174 ACTTCTCTACAGATGGAGAGTGG - Intergenic
911452223 1:98077918-98077940 CCTTCTTGACAATTGGTGAGGGG - Intergenic
912720083 1:112012638-112012660 CCTCCTTTTGAGATGGTGAGAGG + Intergenic
915650334 1:157305441-157305463 CCATGTGTACAGATGCAGAGTGG - Intergenic
915790820 1:158669062-158669084 CCTACTATACGGATGCAGAGGGG + Intronic
916647333 1:166798579-166798601 TCTTCTATAAAGAAGCTGAGGGG + Intergenic
916653045 1:166848694-166848716 CCTTCTTTGCAGATGAAGAAGGG - Intronic
918187008 1:182136602-182136624 CATTCTTATCAGAGGCTGAGGGG + Intergenic
923187317 1:231586760-231586782 CCTTCTCTCAAGATGCTGACAGG + Intronic
923518507 1:234717866-234717888 GCTTATTTACTGATCCTGAGAGG - Intergenic
1062938803 10:1406850-1406872 CCTACTTCACAGATGATGAATGG + Intronic
1066026003 10:31361622-31361644 CCTCCCTTACAAATGGTGAGGGG + Intronic
1066541368 10:36450138-36450160 CCTTCTTTGCTGGTGCTAAGTGG + Intergenic
1069823657 10:71242423-71242445 GCTTCTTTCCAGCAGCTGAGTGG + Intronic
1075781973 10:125022932-125022954 CCCTCTATACAGATTCTGATAGG + Intronic
1079966473 11:26986228-26986250 CCTTCTTTGCACATGCTGGTAGG + Intergenic
1080804400 11:35639209-35639231 CCTTCTTTATTGATGTTGATGGG + Intergenic
1083485739 11:62982000-62982022 CCCTCTTTCCAGATGTGGAGTGG - Exonic
1083785031 11:64939757-64939779 TTTTCCTTACAGATTCTGAGTGG - Exonic
1084234061 11:67774969-67774991 CCTTCTTGATAGATGCAGAGAGG + Intergenic
1088860934 11:113799092-113799114 CCTTCTTTACACATGCAGCATGG + Exonic
1089368169 11:117933842-117933864 CCTCCCTTAGAGCTGCTGAGAGG - Intergenic
1094476728 12:30846209-30846231 CCTGCTTTTCAGCTGCTGTGAGG - Intergenic
1095410112 12:41912158-41912180 CCTTCTGTCCAGAGGCTGACTGG - Intergenic
1103383843 12:120516095-120516117 CTTTCTTTACAGGAGATGAGAGG + Intronic
1105060043 12:133141107-133141129 CCTTCTTGATAGATACTGATTGG - Intronic
1105253071 13:18718392-18718414 CATGATTTACAGAAGCTGAGTGG + Intergenic
1106597022 13:31152922-31152944 CCTTCTTTACAGATGCTGAGAGG - Exonic
1107193362 13:37617466-37617488 GCTTCTTAACAGAGGGTGAGAGG + Intergenic
1107899213 13:44995467-44995489 CCTTTTTTAAAGATTCTGATAGG - Intronic
1114600578 14:23953121-23953143 CCTCCTTTACAGGGGCTAAGTGG - Intergenic
1114604812 14:23988265-23988287 CCTCCTTTACAGGGGCTAAGTGG - Intronic
1114610262 14:24035831-24035853 CCTCCTTTACAGGGGCTAAGTGG - Intergenic
1115674810 14:35660775-35660797 CCTTCTTTTTAAAGGCTGAGTGG - Intronic
1116620900 14:47201847-47201869 CCCATTTTACAGATGATGAGTGG - Intronic
1117161977 14:52998564-52998586 GCTTCATTCCAGAGGCTGAGAGG - Intergenic
1117825630 14:59699873-59699895 TCTTCCTTAGAGATGCTGTGTGG - Intronic
1118431337 14:65721665-65721687 ACTTCTTTAGAGTTGCTGTGAGG + Intronic
1121222210 14:92294639-92294661 CTTTAATTGCAGATGCTGAGAGG - Intergenic
1122592736 14:102866947-102866969 GCATCTTTTCATATGCTGAGAGG - Intronic
1123817883 15:23998148-23998170 CATTCTTGACGGCTGCTGAGGGG + Intergenic
1124692822 15:31839570-31839592 GCTTCTGTGCAGGTGCTGAGTGG - Intronic
1129704565 15:77786917-77786939 CCATCTTCACAGCAGCTGAGAGG - Intronic
1130454272 15:84089604-84089626 CTTTTTTTAAAGATGATGAGGGG - Intergenic
1131098324 15:89669808-89669830 CCCTCTTTACAGATGGGGTGGGG + Intronic
1131740486 15:95385043-95385065 CCTTCTTTACAATTGTTGACTGG + Intergenic
1133285624 16:4689309-4689331 CCATCTTCACAGATGTTCAGGGG + Exonic
1139152658 16:64402220-64402242 CCCACTTGACAGATGCTGTGGGG + Intergenic
1142394344 16:89823059-89823081 CTGTCTGTAAAGATGCTGAGAGG + Intronic
1144404285 17:14937581-14937603 CCTTCTGTACATAGGCTGAAGGG + Intergenic
1146323659 17:31867063-31867085 CCTCCTTTACAGATGAGGATGGG + Intronic
1146449691 17:32962883-32962905 CTTTCTTTATAGAGGCTCAGGGG + Intergenic
1146952263 17:36915019-36915041 CCTACCCTACAGCTGCTGAGAGG - Intergenic
1151692160 17:75693350-75693372 CCTTCCTTAAAAATCCTGAGTGG + Intronic
1152050035 17:77966593-77966615 CATTCTTTTTAGATGCTGATGGG + Intergenic
1152673132 17:81621166-81621188 CCTTCTTTTGAGCTGGTGAGGGG - Intronic
1154298954 18:13175855-13175877 CCTTCAAGACAGATCCTGAGTGG + Intergenic
1155258279 18:24017108-24017130 CCTTTTTTAGAGATGGTGGGAGG + Intronic
1157572897 18:48724616-48724638 CCTTCCCTACAGCTGCTGGGCGG + Intronic
1159526963 18:69604646-69604668 CCTTCATGACACATGCTGATCGG + Intronic
1161655958 19:5515076-5515098 CCACCTTTACAGATGGGGAGTGG - Intergenic
1163068973 19:14822036-14822058 CCTTCTTTTTAAAGGCTGAGTGG + Intronic
1164139943 19:22450558-22450580 CCTTATTTACAGATTCTAGGTGG - Intronic
1165804040 19:38569570-38569592 CCTGCTTTACAGAAGATGAAAGG - Intronic
1167829592 19:52008487-52008509 CCTTCTATTCAGCTGCTGAAAGG - Intergenic
925186687 2:1851809-1851831 CCTACTTGAAAGAGGCTGAGTGG + Intronic
927155297 2:20217806-20217828 CCTTCATTCCTGCTGCTGAGCGG + Intronic
928596544 2:32864300-32864322 TCTTCTTTATAGCTGCTGATGGG + Intergenic
929230280 2:39552533-39552555 CCTTCTTTTTAAAGGCTGAGTGG + Intergenic
935369772 2:102333075-102333097 ACGTCTTTACAGAAGCTGGGAGG - Intronic
936158707 2:110068268-110068290 CTTTCATTTCAGATGCAGAGTGG - Intergenic
936185953 2:110303056-110303078 CTTTCATTTCAGATGCAGAGTGG + Intergenic
936627745 2:114166530-114166552 TCTTCTCTCCAGGTGCTGAGAGG - Intergenic
936869660 2:117120298-117120320 CCTTATTTGCAGATGATGATAGG - Intergenic
937091509 2:119209442-119209464 AGTGCTTTCCAGATGCTGAGTGG + Intergenic
940580029 2:155566917-155566939 CCTTCTTAACATATTTTGAGAGG + Intergenic
940793537 2:158053116-158053138 CCTTCTTTACACTTGGTGTGGGG - Intronic
942171134 2:173290743-173290765 CCTGCTCTGCAGCTGCTGAGTGG - Intergenic
942427701 2:175877116-175877138 CCTTCCTTCCAGAGGCTGAAAGG - Intergenic
944398105 2:199292726-199292748 ACTGCTTTCCAGATGCTGAGTGG - Intronic
945209253 2:207365247-207365269 CTATCTTTGCAGATGCTGAAGGG + Intergenic
945414897 2:209558949-209558971 TCTTCATTACAGAGGCAGAGAGG - Intronic
947508260 2:230726804-230726826 CCTTCCCTACAGAAGCTGAAAGG + Intronic
948177221 2:235953636-235953658 TTTTCTTTACAGATGCTCAGTGG - Intronic
948228466 2:236332163-236332185 GCGTGTTTACAGTTGCTGAGGGG - Intronic
1174823646 20:53749252-53749274 CCTTCTTGACAACTGCAGAGGGG - Intergenic
1176838576 21:13818277-13818299 CATGATTTACAGAAGCTGAGTGG + Intergenic
1176937059 21:14879665-14879687 TCTTCCTTACAGCTGTTGAGAGG - Intergenic
1179532857 21:42032067-42032089 CTTTCCTTACAGATGTTGTGAGG + Intergenic
1181986664 22:26804736-26804758 CCTACTTTACAGATGAGGAAAGG + Intergenic
1185084686 22:48734023-48734045 CCTTTTTTGCATATGCAGAGTGG - Intronic
950763567 3:15256645-15256667 TCTACTTTATAGAAGCTGAGTGG + Intronic
950811075 3:15650639-15650661 TCTTCTCTAGAGCTGCTGAGAGG - Intergenic
959744382 3:109759632-109759654 CCTTCTTTGCAGATGCTGCTGGG - Intergenic
961883690 3:130081512-130081534 CCTTCTTGATAGATGCAGGGAGG + Intergenic
962360021 3:134732142-134732164 GTTTCTTTACAGATGATGAGAGG - Intronic
963611524 3:147474868-147474890 TCTACTTTACAGATGATGAAAGG + Intronic
963616462 3:147544612-147544634 ACTTCTTTAGAAATACTGAGGGG + Intergenic
964715959 3:159721866-159721888 CTTTCTAGCCAGATGCTGAGTGG - Intronic
968022893 3:195410633-195410655 CCTTCTTTTCATGTGCTGATTGG - Intronic
969567937 4:7991200-7991222 CCTTCTCTGCAGATGCTGAGAGG + Intronic
969821083 4:9720791-9720813 CCTTCTTGATAGACGCAGAGAGG - Intergenic
970345431 4:15148247-15148269 CCTTCGGCACAGATGCTGCGGGG - Intergenic
972287585 4:37663592-37663614 GCTTCCTTACAGATGCTGCGAGG - Intronic
973219888 4:47713355-47713377 TCTTCCTTAAAAATGCTGAGTGG - Intronic
975668953 4:76760965-76760987 CCTGCTTTACAGTTGCAGTGTGG + Intronic
978369386 4:108015461-108015483 CATTCTTGACAGATTCTGAGGGG + Intronic
978841224 4:113215285-113215307 CCTTCTTTACAGATGGGGAATGG - Intronic
979507093 4:121510699-121510721 TCTTCCTTACACATCCTGAGAGG - Intergenic
980976953 4:139620327-139620349 CCCTCTTTACAGATGAAGAAAGG + Intergenic
981146860 4:141333753-141333775 CCTTTTATAAAGATACTGAGAGG - Intergenic
982182144 4:152758728-152758750 TCCTCTCTAGAGATGCTGAGAGG + Intronic
982717490 4:158824422-158824444 CCTTGCTTAGAGAAGCTGAGGGG - Intronic
985984290 5:3501852-3501874 CACTCTTTTCACATGCTGAGTGG - Intergenic
987419461 5:17701690-17701712 AGTTCCTTACAGATGCTGGGTGG + Intergenic
988973948 5:36496746-36496768 CCTTCTTTTCAGTTTGTGAGAGG + Intergenic
989271826 5:39542622-39542644 CTTTCTTCACTTATGCTGAGTGG - Intergenic
992227725 5:74635246-74635268 CCTGCTTTAGAGAGACTGAGGGG + Exonic
992427484 5:76672694-76672716 CATTCTATACAGATCCTGTGTGG - Intronic
993109615 5:83641038-83641060 GCTTCTTTACATAAACTGAGAGG - Exonic
994430373 5:99651475-99651497 ACTTATTTAAAAATGCTGAGTGG + Intergenic
995589081 5:113679827-113679849 ACTCCCTTACAGAAGCTGAGAGG + Intergenic
998202399 5:140135465-140135487 CCCTGTTTCCAAATGCTGAGGGG + Intergenic
998963479 5:147512227-147512249 CCTTCTTAACAAATGCTGGTTGG + Intergenic
999519225 5:152333365-152333387 CCTTCTTTAGAGGTGCTGCCTGG + Intergenic
1000359805 5:160436384-160436406 CCCTCTTCACTGATGCTGATGGG + Intergenic
1001841845 5:174883075-174883097 ACTTTTTTTCAGATTCTGAGAGG + Intergenic
1002534910 5:179870670-179870692 CCTTGTTAACAGATGGGGAGGGG + Intronic
1002883243 6:1271488-1271510 CCCTTTTTACAGATGATGAATGG + Intergenic
1004498950 6:16191842-16191864 CCTTCTTTACAAAAGCTTAAAGG + Intergenic
1006168859 6:32081663-32081685 CCTTGTTTACAGCTCCAGAGAGG - Intronic
1008440977 6:51531596-51531618 TCTTTTTTAAACATGCTGAGGGG - Intergenic
1008657839 6:53633863-53633885 CCTACTTTAAAGATACAGAGAGG + Intergenic
1008804173 6:55407597-55407619 CCATGCTTACAGTTGCTGAGTGG + Intergenic
1008946741 6:57106108-57106130 CCTTGTTTACAGTACCTGAGAGG - Intronic
1009398288 6:63228110-63228132 CCTCCCTTACAAATGGTGAGGGG + Intergenic
1016918301 6:149265596-149265618 CTTTCAGTACAGATGCTGGGTGG - Intronic
1018215009 6:161518284-161518306 CCTGCTTTCCAGAAGATGAGAGG + Intronic
1018396114 6:163379223-163379245 CCTTCCTCACAGCTGCTAAGAGG + Intergenic
1019051080 6:169184555-169184577 TCTTCTTAACAAATGCTAAGAGG + Intergenic
1020317670 7:6918048-6918070 CCTTCTTGATAGATGCAGAGAGG + Intergenic
1021170220 7:17390682-17390704 CATTCGTTACTGAAGCTGAGGGG + Intergenic
1021913161 7:25406262-25406284 CCCACTTAACAGATGATGAGAGG - Intergenic
1023194853 7:37623809-37623831 CCTTGCTTAAAGATGTTGAGAGG + Intergenic
1023514185 7:40984122-40984144 CTTTCATTACAGAGGCTGAAAGG - Intergenic
1026463577 7:70634994-70635016 CCCTCTTTACAGATGGTGAAGGG - Intronic
1026821085 7:73549499-73549521 CCTTTTTTAGAGATGGTGGGGGG - Intronic
1028448739 7:90955992-90956014 TCTCCTTTGCAGATGCTGTGTGG + Intronic
1030472703 7:109986786-109986808 TCTTCTCTGCACATGCTGAGAGG - Intergenic
1031844187 7:126784603-126784625 CCTTCTTCACAGAAGCTGAAAGG + Intronic
1032128513 7:129211465-129211487 CCTTCTCTTCAGATTCTGAAGGG + Intronic
1032599987 7:133283381-133283403 CCTTCTTTTTAAATGCTGAATGG + Intronic
1036451426 8:8871186-8871208 CCTGGTTTACAGATGAGGAGTGG - Intronic
1036762052 8:11516071-11516093 CCTTCCTTTCAAAGGCTGAGTGG - Intronic
1038032823 8:23659534-23659556 GCTTCTTCACAGATGCTGGAAGG + Intergenic
1039277004 8:35944232-35944254 CCCTCCTGACAGATGCTCAGAGG + Intergenic
1044020993 8:87105816-87105838 CCTTTTTTCCTGATCCTGAGAGG + Intronic
1050713332 9:8491119-8491141 CCTTCTTCCCAGATGCAGTGGGG + Intronic
1055266111 9:74497882-74497904 CCTTCTTCACTCGTGCTGAGCGG + Exonic
1055271452 9:74564193-74564215 CCATCTTTACAGAGACTCAGAGG - Intronic
1055417999 9:76105104-76105126 CCTTCTTCACAATAGCTGAGAGG + Intronic
1056533155 9:87505084-87505106 ACTTCTTTCCAGATGATTAGGGG + Intronic
1057753770 9:97813396-97813418 GCTTCTTTTCACATGCTGATTGG + Intergenic
1060667985 9:125444395-125444417 CCTTCTATAGAGCTGCGGAGTGG + Intronic
1061838616 9:133344996-133345018 CATTCTTTAAAGCTGCCGAGTGG + Intronic
1062153758 9:135034448-135034470 CCGTCTTTTGAGATTCTGAGTGG - Intergenic
1062709685 9:137967988-137968010 CCTTTTTTTCATCTGCTGAGTGG + Intronic
1187044037 X:15627986-15628008 CCTTCATGACAGAGGATGAGAGG - Exonic
1187213253 X:17250284-17250306 CTCTCATTACAGAAGCTGAGGGG + Intergenic
1187679890 X:21757286-21757308 TCTGCTTTAAATATGCTGAGAGG + Intronic
1189555022 X:42134074-42134096 CCATTTTTACAGAAACTGAGGGG - Intergenic
1191913226 X:66173780-66173802 CCTCTTTTACAGGTGATGAGAGG - Exonic
1194655498 X:96568711-96568733 GCTTCTTTAATGATGTTGAGTGG + Intergenic
1197234795 X:124048728-124048750 CCTTCTTTACAGTTCTTTAGTGG + Intronic
1199814533 X:151386132-151386154 CCTGCATTACAGGTGCTCAGAGG - Intergenic