ID: 1106597157

View in Genome Browser
Species Human (GRCh38)
Location 13:31154868-31154890
Sequence TTGTAGTTGTTTTGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 632
Summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 584}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106597151_1106597157 23 Left 1106597151 13:31154822-31154844 CCAAAAATTAGCACACATTCCCT 0: 1
1: 0
2: 0
3: 23
4: 295
Right 1106597157 13:31154868-31154890 TTGTAGTTGTTTTGGGAAGAAGG 0: 1
1: 0
2: 2
3: 45
4: 584
1106597152_1106597157 4 Left 1106597152 13:31154841-31154863 CCCTTCCACAAAATCTTTATTTT 0: 1
1: 0
2: 2
3: 108
4: 904
Right 1106597157 13:31154868-31154890 TTGTAGTTGTTTTGGGAAGAAGG 0: 1
1: 0
2: 2
3: 45
4: 584
1106597154_1106597157 -1 Left 1106597154 13:31154846-31154868 CCACAAAATCTTTATTTTATTGT 0: 1
1: 0
2: 9
3: 130
4: 1224
Right 1106597157 13:31154868-31154890 TTGTAGTTGTTTTGGGAAGAAGG 0: 1
1: 0
2: 2
3: 45
4: 584
1106597153_1106597157 3 Left 1106597153 13:31154842-31154864 CCTTCCACAAAATCTTTATTTTA 0: 1
1: 0
2: 2
3: 66
4: 754
Right 1106597157 13:31154868-31154890 TTGTAGTTGTTTTGGGAAGAAGG 0: 1
1: 0
2: 2
3: 45
4: 584

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106597157 Original CRISPR TTGTAGTTGTTTTGGGAAGA AGG Intronic
900490885 1:2948603-2948625 TTGTGGTGCTCTTGGGAAGAGGG + Intergenic
901289540 1:8112995-8113017 TTGTTGTTGTTTTGGAGACAGGG - Intergenic
901330719 1:8406007-8406029 TTGTAGTTGTTAGGGGGAAAGGG - Intronic
901525485 1:9819887-9819909 TTTCAGCTTTTTTGGGAAGATGG - Intronic
901721597 1:11202895-11202917 TTGTTTTTGTTTTGGAAACAGGG - Intronic
902249292 1:15142954-15142976 GTGTTGTTTTTTTGGGCAGATGG - Intergenic
902497460 1:16883691-16883713 TTGTTGTTGTTTTGGGGGGTGGG + Intronic
902945340 1:19832431-19832453 TTGTATTTTTTTTGGAGAGATGG - Intergenic
903098314 1:21002297-21002319 TTCCAGTGGTTTTGGGAAGCAGG - Intronic
904738669 1:32654691-32654713 TTGTTGTTGTTTTGAGACGGAGG + Intronic
905383983 1:37586484-37586506 TTGTTTTTGTTTTGGGGAGGAGG - Intronic
905830904 1:41066578-41066600 TTGTTGTTGTTTTGGAGACAGGG + Intronic
906123340 1:43410378-43410400 TTGTAGTTTTTTAGTAAAGATGG - Intronic
906797145 1:48707285-48707307 TTGTTGTTGTTTTGGATATAGGG - Intronic
907085477 1:51668685-51668707 TACAAGTTGTTTTGGGAAGGCGG - Intronic
907144291 1:52218786-52218808 TTTTTGTGGTTTTGGGAAGCGGG + Intronic
907719909 1:56962025-56962047 TTGTAGTTGAAATAGGAAGAGGG - Intronic
908515882 1:64892454-64892476 TTGTTGTTGTTTTTGGGAAAGGG + Intronic
908984749 1:70004045-70004067 TTCTAGTTGTTTTAGATAGATGG + Intronic
909635134 1:77809096-77809118 TTGTTGTTGTTTTAAGAAAACGG - Intronic
909707582 1:78605680-78605702 TTGTAGTTTTTTAGTAAAGACGG - Intergenic
910158133 1:84243775-84243797 TTGTAATTTTTTTGTGAGGAAGG + Intergenic
910172676 1:84394592-84394614 ATGTACTTGTTGTGGGAGGATGG - Intergenic
911505417 1:98743728-98743750 TTCTTGTTGTGTTGGGAAAATGG + Intronic
911596433 1:99803196-99803218 TTGTTGTTGTTTTGGCAAAAGGG - Intergenic
912392750 1:109315928-109315950 TTGTATTTTTTTTGTAAAGATGG + Intronic
913657528 1:120975470-120975492 GTGGAGTTATTCTGGGAAGAGGG - Intergenic
914008878 1:143758553-143758575 GTGGAGTTATTCTGGGAAGAGGG - Intergenic
914255589 1:145959595-145959617 TTGTAGTTGTTGGAGGAACAGGG + Exonic
914522094 1:148426743-148426765 GTGGAGTTATTCTGGGAAGAGGG - Intergenic
916048084 1:161015662-161015684 TTGTTGTTGTTTTTGAAACAGGG - Intronic
916434107 1:164760551-164760573 TTGTTGTTGTTTTGGGGGGCAGG - Intronic
916753767 1:167747912-167747934 TAGTAGTTGCTAGGGGAAGAGGG - Intronic
917082932 1:171274432-171274454 TTGTATTTTTTTTGTAAAGATGG + Intronic
917441724 1:175074310-175074332 TTGTATTTTTTTTGTGGAGATGG - Intronic
917604348 1:176611184-176611206 TTGAGGTTGTTTTTGAAAGATGG + Intronic
917785795 1:178456312-178456334 TTGAAGTTCTTTTGGTTAGAAGG + Intronic
918000935 1:180494958-180494980 TTATAGTACTCTTGGGAAGAAGG - Intronic
918287041 1:183067491-183067513 TTGTTGTTGTTTTTGAGAGACGG + Intronic
918438637 1:184543173-184543195 TTTTAATTTTTTTGTGAAGAAGG - Intronic
918508370 1:185282659-185282681 TTGTAGTTGTTGTCTGAAGTGGG + Intronic
918667189 1:187166317-187166339 TTGTGGTGGTGTTGGGAAGTGGG + Intergenic
919611553 1:199751369-199751391 TTGTTGTTGTTTTGGGATGGGGG + Intergenic
920030128 1:203032437-203032459 TTGTTGTTGTTTTTGAAATAGGG + Intronic
920609907 1:207425921-207425943 TTAAAGTTTTTTTAGGAAGAAGG + Intergenic
920675397 1:208034629-208034651 ATGTAGGTGTCTTGGGAAGTTGG + Intronic
920818138 1:209354800-209354822 TTGTTGTTGTTGTGGGGAGGAGG + Intergenic
920970523 1:210739701-210739723 TTGTAGTTGTATTTGGAAATTGG + Intronic
921141740 1:212314383-212314405 TTGTTGTTGTTTTTTTAAGATGG + Intronic
921737844 1:218649174-218649196 TTGTAGTTCTCTTTGAAAGAAGG + Intergenic
922246406 1:223802694-223802716 TTGTAATGGTTTTGGGGAGGAGG - Intronic
922875564 1:228937345-228937367 TGGAAGTTGTTTTCTGAAGAAGG + Intergenic
923703808 1:236326401-236326423 TTGTTGTTGTTTTGTTTAGATGG - Intergenic
923797278 1:237170038-237170060 TTGAAGTTTATTTTGGAAGATGG + Intronic
924608740 1:245556711-245556733 TTGTTGTTGTTTTGAGATGGAGG + Intronic
1063578423 10:7282836-7282858 TTGTAGCTGTATTTGGAATAAGG - Intronic
1063755097 10:8998436-8998458 TTGAACTTGTTTTGGCAGGAGGG + Intergenic
1063785114 10:9373663-9373685 TAGTAGTTGCTTAGGGCAGAGGG - Intergenic
1064082247 10:12318171-12318193 ATGTAGCTGTTTTGGGAGGTAGG + Intergenic
1064415264 10:15143846-15143868 TTGTAGTTGTTTTTGAGACAGGG - Intronic
1065913226 10:30328939-30328961 TTGTTGTTGTTTTTGAAACAGGG + Intronic
1066405252 10:35112268-35112290 TTCTAGTTGTTTTAGGCAGAAGG - Intergenic
1066592926 10:37015456-37015478 TAGTATTTATTTTGGAAAGATGG - Intergenic
1067987057 10:51161578-51161600 CTGTACTTGTTTTGAGATGATGG + Intronic
1067999466 10:51314944-51314966 TTACAGTTGTTTTGGAAAAATGG - Intronic
1068732224 10:60372236-60372258 TCACAGTTGTTTTGGGGAGAAGG - Intronic
1069563861 10:69450572-69450594 TTGTTTTTGTTTTGGAGAGAGGG + Intergenic
1069651983 10:70055414-70055436 TTGTTGTTGTTTTGAGATGGGGG + Intronic
1069870623 10:71530608-71530630 TTGTAGGTGCTTGGGAAAGAGGG - Intronic
1069951999 10:72025456-72025478 GTGGAGTTGTTGTGGGAAGTGGG - Intergenic
1070296307 10:75164209-75164231 TTGTTGTTGTTTTTGAAACAGGG - Intronic
1070299865 10:75195689-75195711 TTGTAGTTTTTTTGGGGGGTTGG - Intergenic
1070446077 10:76504465-76504487 TTGTAGTTGTTTTATGAATCTGG + Intronic
1070745480 10:78931229-78931251 GTGCAGTTGTTTTGAAAAGAAGG + Intergenic
1070839120 10:79470953-79470975 TTGTATTTTTTTTGTGGAGATGG + Intergenic
1071770434 10:88723056-88723078 TTGTATTTGTTTTAGAAACAGGG + Intergenic
1072047800 10:91674019-91674041 TTGTATTTTTTTTGTGGAGATGG - Intergenic
1072108657 10:92297338-92297360 TTGTATTTTTTTTGTGGAGATGG + Intronic
1072272074 10:93786601-93786623 TTGTTGTTGTTTTTGAAACAAGG + Intronic
1073343655 10:102765403-102765425 TTGTATTTTTTTTGTGGAGATGG + Intronic
1073387772 10:103141449-103141471 TTGTTATTTTTTTGGGAACAGGG - Intronic
1073443377 10:103565821-103565843 TTGTAGTTTTTTTGTAGAGAAGG + Intronic
1073473218 10:103736656-103736678 TTGTGGATGTTCTGGAAAGAGGG - Intronic
1073967175 10:109004030-109004052 TTGTAATGGTATTGGGAAGTGGG + Intergenic
1074089368 10:110233338-110233360 TTTTAGTTTTTCTGGGGAGAGGG + Intronic
1074203554 10:111260695-111260717 TTGTTTTTGTTTTGTGGAGATGG + Intergenic
1075771924 10:124945957-124945979 TTGTATTTTTTTTGGAGAGACGG + Intronic
1076689341 10:132213336-132213358 CTGTGGGTGTGTTGGGAAGATGG - Intronic
1076947534 10:133661494-133661516 TGGTGGTTCTTTTGGGAAAAAGG + Intergenic
1077514575 11:2993668-2993690 TTGTTGTTGTTTTTGGAGCAGGG - Intergenic
1077822868 11:5767344-5767366 CTGTAGTGGTATTGGGAAGTGGG - Intronic
1078071643 11:8115982-8116004 TTGTAGTAGATTTGGGAATCAGG - Intronic
1078212678 11:9283439-9283461 CTTTAGTTTTTTTTGGAAGATGG + Exonic
1078953332 11:16160877-16160899 TTGTAGTTTTTTTGAGAATTTGG - Intronic
1079438616 11:20484810-20484832 TTGTAGCTGTTTTCGGCAAAAGG - Intronic
1079714326 11:23725625-23725647 TTGTTGTTGTTTTTGCAACAGGG - Intergenic
1080237432 11:30088020-30088042 ATGTAGTTGCTTTGAGAAAAAGG + Intergenic
1080670152 11:34368850-34368872 TTGTAATTGTTTTGGCAGTATGG - Intergenic
1081460125 11:43264920-43264942 TTGTATTTGTTTAGTAAAGACGG - Intergenic
1082858577 11:57831599-57831621 TTGTATTTTTTTTGGAGAGACGG + Intergenic
1083071790 11:59992173-59992195 TTTTTCTTGTTTTGTGAAGAAGG + Intergenic
1083929051 11:65829189-65829211 TTGTTGTTGTTTTTGAAATAGGG - Intronic
1084201905 11:67564927-67564949 TTGTTGTTGTTTTGAGATGGAGG - Intergenic
1085428948 11:76430051-76430073 TCGTAGTTGAGTGGGGAAGATGG - Intergenic
1085895393 11:80633107-80633129 TAGTATTTATTTTGGAAAGATGG + Intergenic
1086382455 11:86271059-86271081 TGGGAGTTGTTTTGAGGAGAAGG + Intronic
1086590077 11:88504930-88504952 TTATAGATGTTTTAGAAAGATGG - Intronic
1087165029 11:94994598-94994620 TTGTAGGAGTTTTAGGAGGAAGG + Intronic
1087356116 11:97096946-97096968 TTGTTGTTGTTTTTCCAAGAGGG + Intergenic
1087883340 11:103446059-103446081 TTGTTGTTGTTTAGGGAGGAGGG + Intronic
1088804020 11:113334420-113334442 TTGTGGTTTATTTGGGAGGAGGG + Intronic
1088888304 11:114024873-114024895 TTGGAGTTGGCCTGGGAAGAGGG + Intergenic
1089020538 11:115209619-115209641 TGGTGGTTGTTGTGGGAGGAGGG + Exonic
1089650985 11:119912712-119912734 TTGTAGTTGTTTTATAGAGATGG - Intergenic
1089817965 11:121193436-121193458 TTGTATTTTTTTTGTGGAGATGG - Intergenic
1090090157 11:123689445-123689467 TTGTAGTTCTTTTGAAAAGTAGG - Intergenic
1090095296 11:123736907-123736929 TTGAAATCGTTTTGGGAAGAAGG + Intronic
1090282783 11:125470542-125470564 TTGTAGTTGTTTATGGTAGGAGG - Intronic
1090509009 11:127351847-127351869 TTGTTTTTGTCTTGGGGAGAAGG + Intergenic
1090600814 11:128369159-128369181 TAGTAGTTATTTTAAGAAGATGG - Intergenic
1091471891 12:735924-735946 TTGTTCTTATTTTGGGATGATGG + Intergenic
1092555392 12:9554870-9554892 TTGTATTTGTTTGAGGAATACGG - Intergenic
1092600525 12:10057572-10057594 TTGTTATTGTTTTGGGAATATGG + Intronic
1092837765 12:12507611-12507633 TTGTTGTTGTTTTTTGGAGATGG + Intronic
1093398875 12:18718303-18718325 TAGAAGATGATTTGGGAAGATGG - Intronic
1094300312 12:28957340-28957362 TTGAAGTCTTTTTGGGAGGAGGG - Intergenic
1094516707 12:31135812-31135834 TTGTATTTGTTTGAGGAATATGG + Intergenic
1094794434 12:33954469-33954491 TTGTGGTGGTGTTGGGAAGTGGG - Intergenic
1095611398 12:44132731-44132753 TTGTAGTAAATTTTGGAAGAGGG + Intronic
1095785644 12:46106285-46106307 TTTTAATTGTTTTGTAAAGATGG + Intergenic
1095910393 12:47420220-47420242 TTGAAGTTGTTTCATGAAGAAGG - Intergenic
1096291534 12:50347910-50347932 TTGTTGTTTTTTTGAGACGACGG + Intronic
1096655940 12:53092160-53092182 TTGTGGGTGTTTTGAGAATAGGG - Intergenic
1096752069 12:53766708-53766730 TTTCATTTGTTTTGGGAGGATGG - Intergenic
1096827203 12:54288900-54288922 TTGTATTTTTTTTGGGCAGGGGG - Intergenic
1096947921 12:55430338-55430360 TTGTTGTTGTTTTGGAGAGTAGG - Intergenic
1097590884 12:61573835-61573857 ATGTGGATGTTTTGGGGAGATGG + Intergenic
1099003877 12:77214662-77214684 TGGGAATTGATTTGGGAAGAGGG + Intergenic
1099257067 12:80327474-80327496 TTGCAGTTCTTTTGAGAACAGGG - Intronic
1099391440 12:82084985-82085007 TTGTAGTTGATTTTGCAATATGG + Intergenic
1099448730 12:82783258-82783280 TTGTAGCTGTTTTAACAAGAAGG + Intronic
1099612861 12:84897018-84897040 TTGTATTTTTTTAGGGGAGAGGG - Intronic
1099752623 12:86797066-86797088 TTCTCCTTGTATTGGGAAGATGG - Intronic
1100816932 12:98395753-98395775 TTGTTTTTGATTTGGGGAGAGGG + Intergenic
1100835457 12:98562900-98562922 TTGTTGTTGTTTTGGAGACAGGG - Intergenic
1101055345 12:100906766-100906788 CTGAAGGTGTTTGGGGAAGAGGG + Intronic
1101178845 12:102188166-102188188 TTGTAGTTGTGTGGGGAGGTAGG + Intronic
1101658122 12:106742191-106742213 TTGTTGTTGTTTTTGAAACAGGG + Intronic
1101689049 12:107057886-107057908 TTGTTGTTTTTTTGGAGAGACGG - Intronic
1101955771 12:109211421-109211443 TTGTATTTTTTTAGTGAAGATGG + Intronic
1102195699 12:111023774-111023796 TTGTGTTTGGTTTGGGAGGAAGG + Intergenic
1102285036 12:111648992-111649014 TTGTTGTTGTTTTGGAGACAGGG - Intronic
1102379573 12:112452696-112452718 TTTTAATTGTTTTGTGAAGATGG + Intronic
1102391163 12:112549914-112549936 TTGTTGTTGTTTTGTAGAGACGG + Intergenic
1102644910 12:114397555-114397577 TTGTTTTTCTTTGGGGAAGAGGG + Intronic
1102674514 12:114647960-114647982 TTGTTGTTGTTTTGCAGAGATGG - Intergenic
1102727925 12:115081804-115081826 ATGCAGTTGTCCTGGGAAGATGG + Intergenic
1102939571 12:116927590-116927612 TGGTGGTTGTCCTGGGAAGAGGG + Intronic
1103454859 12:121057278-121057300 TTGTTTCTGTATTGGGAAGAAGG - Intergenic
1104136480 12:125944471-125944493 TTGTTGTTGTTTTAGGCAGGAGG - Intergenic
1104186418 12:126436370-126436392 TTGTATTTGTTTTGCAGAGATGG - Intergenic
1104522989 12:129492709-129492731 TTGTATTTGTTTTGGCAAGTGGG + Intronic
1104672702 12:130691497-130691519 TTGTATTTTTTTTGGAGAGATGG - Intronic
1105304089 13:19157181-19157203 TTTGAGTTGTTTTGGAAGGAAGG + Intergenic
1105328101 13:19388660-19388682 TTGTATTTTTTTTGGAGAGATGG - Intergenic
1106173718 13:27310288-27310310 TTGTATTTTTTTTGTGGAGACGG + Intergenic
1106597157 13:31154868-31154890 TTGTAGTTGTTTTGGGAAGAAGG + Intronic
1108323829 13:49310678-49310700 CTGTAATTGTTCTGGGTAGATGG - Exonic
1108566674 13:51706332-51706354 TTGCAGCTGTCTTGGGGAGATGG + Intronic
1109018185 13:57048008-57048030 TTGTGTTTGTTGTGGGAACATGG - Intergenic
1109069098 13:57740054-57740076 TTGTTGTTGTTTTGGGGGGTTGG + Intergenic
1109576094 13:64261575-64261597 TTTCAGTTGTTTTAGGAAGGAGG - Intergenic
1109697564 13:65979936-65979958 TTGTTGTTGTTGTTGGATGATGG + Intergenic
1109894062 13:68659046-68659068 GTGTATTTGTTGGGGGAAGAAGG - Intergenic
1110101642 13:71613716-71613738 TTGTGGTTGTTTTTGAGAGAGGG + Intronic
1110801085 13:79695885-79695907 ATGTATATGTTTAGGGAAGAAGG + Intergenic
1110855291 13:80290427-80290449 TTGTTGTTGTTTTGGTATCAGGG - Intergenic
1111200709 13:84932378-84932400 TTGTAGTTTTTTTGTGGAGATGG + Intergenic
1111216698 13:85152276-85152298 TTGTTTTTGTTTTGTGGAGATGG + Intergenic
1111382608 13:87478469-87478491 TTTTATTTTTTTTGTGAAGACGG - Intergenic
1111707727 13:91771711-91771733 TTTTAGTTGTTTTCCGAAAAAGG + Intronic
1111713415 13:91846824-91846846 TTGAAGAGGTTTTGGGAAAATGG + Intronic
1112364923 13:98748463-98748485 TTGTATTTTTTTTGTGGAGACGG + Intronic
1112796393 13:103060873-103060895 TTGTTGTTGTTTTGGGGGGCAGG - Intronic
1113026562 13:105947016-105947038 TAGGAGCTGTTTTGAGAAGATGG + Intergenic
1114930709 14:27464672-27464694 TTCTTGTTGCCTTGGGAAGAAGG + Intergenic
1115255151 14:31392978-31393000 TTGTTGTTGTTTTTGGAAACAGG - Intronic
1116434731 14:44884386-44884408 TTGTATTTTTTTTGTAAAGATGG - Intergenic
1117251537 14:53944429-53944451 AAGTAGTTGTTTTAGGAGGATGG + Intergenic
1117637570 14:57761212-57761234 TTTTAATTGTTTTAGGTAGAAGG + Intronic
1117715065 14:58572024-58572046 TTGTACCTGATTTGGAAAGACGG - Intergenic
1117716420 14:58586324-58586346 TTGTATTTTTTTTGTGGAGATGG + Intergenic
1118009447 14:61594468-61594490 ATGTAGTAGTTGTGGGGAGATGG + Intronic
1118134855 14:63012018-63012040 TTGTTTTTGTTTTGGATAGAGGG - Intronic
1118811528 14:69278177-69278199 TTTTAAATGTTTTGGAAAGACGG + Intronic
1118861754 14:69669618-69669640 TTGAAGATGTTTAGGGGAGAAGG - Intronic
1119045865 14:71318331-71318353 TTATAGTTATTTTGGGAGTATGG + Intergenic
1119127640 14:72142569-72142591 TTCCAGCTGGTTTGGGAAGAGGG + Intronic
1119258897 14:73225110-73225132 TTGTTGTTGTTTTGGAGACAAGG + Intergenic
1119886469 14:78147541-78147563 ATGTAGATGTTTGGGGAAAATGG + Intergenic
1119923308 14:78467929-78467951 TTGTTGTTGTTTTGAGATGGAGG + Intronic
1120184287 14:81377849-81377871 TTGTTTTTTTTTTTGGAAGATGG + Intronic
1120589541 14:86359145-86359167 TGGTAATTGGTTTAGGAAGAAGG + Intergenic
1120635507 14:86945531-86945553 TTGTAGTTTATATAGGAAGAAGG + Intergenic
1120915703 14:89708258-89708280 TTTTAATTGTTTTGTGGAGATGG + Intergenic
1120952073 14:90050808-90050830 TGGAAGTTGTTTCTGGAAGATGG + Intergenic
1121348753 14:93155934-93155956 TTGTAGTTTGGATGGGAAGAAGG - Intergenic
1121440951 14:93948931-93948953 TTGTTTTTGTTTTGGGAACAGGG - Intronic
1121711985 14:96045333-96045355 GTGTGGGTGTTTTGGGCAGAGGG + Intronic
1122378290 14:101283645-101283667 TTGTAATTGTTATTGGCAGAAGG + Intergenic
1123502066 15:20896414-20896436 TTGAAATTTTTTTGTGAAGATGG - Intergenic
1123559314 15:21470097-21470119 TTGAAATTTTTTTGTGAAGATGG - Intergenic
1123595549 15:21907394-21907416 TTGAAATTTTTTTGTGAAGATGG - Intergenic
1124227049 15:27903490-27903512 TTGTTGTTGTTTTGTTGAGATGG + Intronic
1124446825 15:29742050-29742072 TTGTTGTTGTTTTGGAGAGATGG - Intronic
1124873158 15:33563934-33563956 TTGCGGTTGTTTTCAGAAGAAGG - Intronic
1125001158 15:34771231-34771253 CTGTAGTTATTTTAGGAAGATGG - Intergenic
1126154812 15:45556074-45556096 TCATTGTTGTTTTGGGGAGAAGG + Intergenic
1128447031 15:67772127-67772149 TTGCATTTGTTTTGGCAACAAGG - Intronic
1129970594 15:79774693-79774715 TTGTAGTTTTTTTGCAGAGATGG - Intergenic
1130026146 15:80272163-80272185 TTGAAGCTGTTTAGGGCAGAAGG - Intergenic
1130380959 15:83372036-83372058 TGGTAGTTGAATGGGGAAGAAGG + Intergenic
1131481794 15:92788626-92788648 TTGTTGTTGTTTTGAGATGGAGG + Intronic
1131558542 15:93419832-93419854 CTGTGCTTGTTTTGGGGAGAGGG + Intergenic
1131735742 15:95329940-95329962 TTGTAGTGGGTTTGGAAAGGAGG + Intergenic
1131794722 15:96004059-96004081 TTGTCATGGTTTTGGAAAGATGG - Intergenic
1131944208 15:97601267-97601289 TTTTAGTTCTTTGGAGAAGAGGG + Intergenic
1131972593 15:97907038-97907060 TTGTAGTTTTTTTGTAGAGATGG - Intergenic
1132193527 15:99891121-99891143 TTATTGGTGTTTTGGGAGGATGG + Intergenic
1132297464 15:100751137-100751159 CTGTAGTTGCTTTGGAAAGTAGG + Intergenic
1133356748 16:5142444-5142466 TTGTTGTTGTTTTGGAGACAAGG - Intergenic
1133453374 16:5921979-5922001 TTGTTTTTTTTTTGTGAAGATGG - Intergenic
1133979571 16:10623086-10623108 TTGTTGTTGTTTTAGAAATAGGG + Intergenic
1134648573 16:15890276-15890298 TTGTATTTATTTTGGAGAGATGG - Intergenic
1134754374 16:16653133-16653155 TGGAAGGTGTTCTGGGAAGAGGG + Intergenic
1134991687 16:18705901-18705923 TGGAAGGTGTTCTGGGAAGAGGG - Intergenic
1135589933 16:23697761-23697783 TTGTTGTTGTTTTAGAAACAGGG + Intronic
1137521360 16:49198191-49198213 TAGGAGTTGTTTTTTGAAGATGG + Intergenic
1138059273 16:53872607-53872629 TTGTAGTTGTTTAAGACAGAAGG + Intronic
1139157644 16:64463468-64463490 TTGTTGTTGTTTTTGGAGTAGGG + Intergenic
1139162328 16:64525999-64526021 TTGTTGTTGCTTTTGTAAGAGGG - Intergenic
1139829011 16:69781517-69781539 TTGTATTTTTTTTGGAGAGATGG + Intronic
1142423960 16:89990904-89990926 CTGCAGTTGCTTTGGCAAGAAGG - Intergenic
1142875814 17:2851741-2851763 TTGTAGTTGTTTGGAGAGGTGGG + Intronic
1143417689 17:6761521-6761543 TGCTAGTTGTTTTGGTAACATGG + Intronic
1143850811 17:9810493-9810515 TTATAGTTTTATTGGGAATAGGG - Intronic
1144106212 17:11988183-11988205 TTTTAGTTGTTTCAGGCAGAAGG - Intronic
1144131128 17:12248896-12248918 TTTTAGTTGTTTCTGGTAGAAGG - Intergenic
1144486413 17:15668688-15668710 TTGTAGCTGGTTGGTGAAGAAGG - Intronic
1144505821 17:15829845-15829867 TTGTTGTTGTTTTAGAGAGAGGG + Intergenic
1144532290 17:16051007-16051029 TTTTAGTTTTTTTGTGGAGATGG + Intronic
1144914607 17:18713604-18713626 TTGTAGCTGGTTGGTGAAGAAGG + Intronic
1145169995 17:20647777-20647799 TTGTTGTTGTTTTAGAGAGAGGG + Intergenic
1145184326 17:20780986-20781008 TTGTTGTTGTTTTGTAGAGATGG + Intergenic
1145354391 17:22127595-22127617 TTATATTTGTTTTTGGAAGCCGG - Intergenic
1147008542 17:37424557-37424579 TTGTTGTTGTTTTGTTGAGACGG + Intronic
1147281443 17:39364434-39364456 TTGTTGTTGTTTTTGAGAGAAGG - Intronic
1148247288 17:46041808-46041830 TTGTAATTATTTTTGAAAGATGG - Intronic
1148447339 17:47745483-47745505 TAGTAGTTGGTTGGGGAAGTGGG + Exonic
1148587376 17:48790669-48790691 TTGTAGGTGTGGTGGGAAGAGGG - Intronic
1148828827 17:50415729-50415751 TTCTAGTTGTTTTGAGAAATAGG + Intergenic
1148888550 17:50791035-50791057 TTGTTGTTGTTTTGTAGAGACGG - Intergenic
1149630656 17:58119597-58119619 TTGTACTTGTTTAAGGAATAGGG + Intergenic
1150942666 17:69710025-69710047 CTGTAATTTTTATGGGAAGAGGG + Intergenic
1151011052 17:70496582-70496604 TTGTTTTTGTTTTTGGAAGGTGG + Intergenic
1151741449 17:75985316-75985338 TTGTATTTTTTTTGTGGAGATGG + Intronic
1151752455 17:76047611-76047633 TTGTATTTGTTTTGTAGAGATGG - Intronic
1151932453 17:77241263-77241285 TTGAACATGTTGTGGGAAGATGG + Intergenic
1152289314 17:79429821-79429843 TTGTTCTTCTTTTGGGAGGAAGG + Intronic
1153800874 18:8667421-8667443 TTGTTGTTGTTTGGAGATGAGGG + Intergenic
1153887684 18:9481320-9481342 TTGTATTTTTTTTGTGGAGACGG + Intronic
1154260553 18:12828499-12828521 TTGTATATGATATGGGAAGAAGG + Intronic
1154348493 18:13564073-13564095 TTGTGGTTTTTTTGTAAAGATGG + Intronic
1155779198 18:29810081-29810103 TTGCAGTTGTTCTGGGAATAGGG - Intergenic
1156174935 18:34532921-34532943 TTGTAGCTCTCTTGGGAGGAAGG + Intronic
1156353847 18:36323851-36323873 TTCTAGTTGTTTTCAGAAGTAGG - Intronic
1156794305 18:41023637-41023659 ATGTAGTTCTTTTGGTAAAAAGG + Intergenic
1157476004 18:48024075-48024097 GGGTAGTTGTGTTAGGAAGAAGG + Intergenic
1157693126 18:49699998-49700020 TTTCAGGTGTCTTGGGAAGAAGG + Intergenic
1157727527 18:49976330-49976352 TTATAACTGTTTTGGGTAGATGG - Intronic
1158226055 18:55202749-55202771 GTGTAGATGTTTTGCAAAGATGG - Intergenic
1159201799 18:65195942-65195964 TTGTTGTAGATTAGGGAAGATGG - Intergenic
1160213629 18:76906607-76906629 TCGTAGTAGTATTGGGAATATGG + Intronic
1160427975 18:78791328-78791350 TTGCTGTTGTTTTTGGAAGAGGG - Intergenic
1161091848 19:2364416-2364438 TTGTTGTTGTTTTGCAGAGATGG + Intergenic
1161569517 19:5022881-5022903 TTGTAGTTTTTATGGGTACAAGG + Intronic
1161659009 19:5534531-5534553 TTGTTGTTGTTTTGGAGACAGGG + Intergenic
1161870713 19:6867643-6867665 TTGCTTTTGTTTTGGGATGAGGG - Intergenic
1162360105 19:10214485-10214507 TTGTTGTTGTTTTGGAGACAGGG - Intronic
1162625612 19:11882199-11882221 TTGGAGTTCTTTAGGGGAGAGGG - Intronic
1163254582 19:16147963-16147985 TTGTTGTTGTTTTTGAAACATGG + Intronic
1163545348 19:17938167-17938189 TTGTACATGTTTTGTGGAGATGG - Intronic
1163647629 19:18498943-18498965 TTGTTGTTGTTTTTTGGAGAAGG - Intronic
1164256771 19:23534157-23534179 TTGTATTTTTTTCGTGAAGACGG - Intronic
1165564549 19:36713282-36713304 TTGTATTTTTTTTGTAAAGATGG - Intronic
1165604565 19:37090500-37090522 TTGTTGTTGTTTTGGAGACAGGG - Intronic
1166554965 19:43692766-43692788 TTGTTGTTGTTTTGTTGAGATGG - Intergenic
1167442931 19:49520001-49520023 TTGTATTTTTTTTGGAGAGATGG + Intronic
1168473371 19:56659107-56659129 TTGTTGTTGTTTTAGAAACAAGG - Intergenic
925395489 2:3530369-3530391 TAGTAGTAGTATGGGGAAGAAGG + Intergenic
925597169 2:5566766-5566788 TTTTATTTATTTTGTGAAGAGGG + Intergenic
925628194 2:5862886-5862908 TTCTAGTTGTCTAGGGAAAAAGG + Intergenic
926072580 2:9910512-9910534 TAGTAGATGTTTTAGGAAGTCGG + Intronic
926627393 2:15103551-15103573 TTGTAAGTTTTTTGGGAAGATGG + Intergenic
927019869 2:19005324-19005346 TTGTTGTTGTTTTGGTTAGGGGG - Intergenic
927797414 2:26062361-26062383 TTGTGTTTGTTTGGGGAGGAGGG - Intronic
929152232 2:38757826-38757848 TTTTAATTGTTTTGTGGAGATGG - Intronic
929426788 2:41851894-41851916 TTGTTGTTGCTTTGGGATGGAGG + Intergenic
929619827 2:43343204-43343226 TTGTCGTTGTTTTGTAGAGATGG + Intronic
929649952 2:43668798-43668820 TTGTTGTTGTTTTGGGGATAGGG - Intronic
931129323 2:59316096-59316118 TTGTAGTTGTTCTTGGCACAAGG - Intergenic
931503727 2:62900449-62900471 TTAAAATTGTTTTGTGAAGATGG - Intronic
932150529 2:69367363-69367385 TTGTTGTTGTTTTGTGGAGACGG + Intronic
932281967 2:70501087-70501109 TTGTATTTGTTATGCGATGAGGG + Intronic
932396323 2:71451188-71451210 ATTTAATTGCTTTGGGAAGAAGG - Intergenic
935140362 2:100348046-100348068 TTGTTGTTGTTTTGGAGAGATGG - Intergenic
935168476 2:100590581-100590603 TCATTGTTGTTTTGGGAGGACGG - Intergenic
935181225 2:100692743-100692765 TGGTTGTTTTGTTGGGAAGAGGG - Intergenic
935473697 2:103491507-103491529 TTGTTGTTGTTGTGGAGAGAGGG + Intergenic
935853342 2:107247315-107247337 TTGTTGTTGTTTTCTGAAAAAGG + Intergenic
936530839 2:113276384-113276406 GTCTATTTGTTTTGGAAAGAGGG + Intronic
937213434 2:120293636-120293658 TTGTAGTGGGTTTTGGAGGAGGG + Exonic
937590194 2:123604260-123604282 TTGTTGTTGTTTTAGGAAGCAGG - Intergenic
938035961 2:128035150-128035172 TTGTATATGTTTTAGGGAGACGG + Intergenic
938258013 2:129875362-129875384 TTGTTTTTGTTTTGGGGACAGGG + Intergenic
938392911 2:130918820-130918842 TTTTTGTTGTTTTGGGGGGAGGG + Intronic
939175853 2:138746556-138746578 TTGTGGCAGTTTTGGGAAGCTGG - Intronic
939265588 2:139868375-139868397 TTTCAGTTTATTTGGGAAGATGG - Intergenic
939471417 2:142626366-142626388 TTGTTGTTGTTTTGTGAGGCAGG + Intergenic
939623581 2:144449442-144449464 TTGTTGTTTTTTAGGGATGAGGG - Intronic
940667589 2:156627570-156627592 TTGTTGTTGTTTTTTAAAGACGG + Intergenic
940715553 2:157219440-157219462 TTGTTGTTGTTTTGGAGACAGGG + Intergenic
940746940 2:157577885-157577907 TTGTTTTTGTTTTGGAAACAGGG + Intronic
940828943 2:158446175-158446197 TTGTAGTTTTTTTGTAGAGATGG - Intronic
942313864 2:174681568-174681590 TTGAAATTGCTTTGGGAAGCTGG + Intronic
942523833 2:176831964-176831986 CTTCAGTTGTTTTGGGTAGAGGG - Intergenic
943272278 2:185821751-185821773 TTGTATTTTTTTTGGAGAGATGG - Intronic
943394556 2:187317252-187317274 TTGTATTTGTTTTGGTAGAAAGG + Intergenic
943983245 2:194583623-194583645 TTTTAGTTGTTTTCAGTAGAGGG + Intergenic
944241434 2:197489231-197489253 TTGTAGGTGTTTGGAGAAGAGGG - Exonic
944297239 2:198080203-198080225 TTGTGTATGTATTGGGAAGATGG - Intronic
944360865 2:198854816-198854838 TTGTATGTGTTTGGGGCAGAGGG - Intergenic
944546977 2:200808912-200808934 TTATGGTTGTTTTGGGAAAAAGG - Intergenic
944746227 2:202659480-202659502 TTGTATTTGTTTTGTAGAGATGG + Intronic
944851544 2:203724744-203724766 TTGTTTTGGTTTTGGTAAGAAGG - Intronic
945111283 2:206362358-206362380 TTTTAGTAGTTTTGGAAGGAAGG - Intergenic
945160804 2:206888519-206888541 TTGTAATTGTTTTGTAGAGATGG - Intergenic
945674832 2:212843571-212843593 ATGTATTTGTGTTGGGAGGAAGG - Intergenic
946318841 2:218936431-218936453 TTATAGAAGTTTTGGGAAGGAGG + Intergenic
947502059 2:230678116-230678138 TTGTTGTTGTTTTTGAAACAGGG - Intergenic
948090042 2:235285826-235285848 GTGTAGGTGGTCTGGGAAGAGGG + Intergenic
948120757 2:235528679-235528701 TTTTGTTTGTTTTGAGAAGACGG + Intronic
1169349361 20:4855742-4855764 GTGAATTTGTTTTGTGAAGAAGG - Exonic
1169834051 20:9858077-9858099 TGGTAGTTATTCTTGGAAGAAGG - Intergenic
1170850309 20:19998424-19998446 TTGTGGTTGTTTTGTCGAGATGG - Intronic
1171040048 20:21754618-21754640 TTCTAGTTGTTCTGGATAGAGGG + Intergenic
1171443970 20:25190400-25190422 TTGTAGTAGATTTTGGAAAATGG + Intergenic
1171574202 20:26286345-26286367 GTGTAGTTTTTATGTGAAGATGG - Intergenic
1171953141 20:31439365-31439387 TTGTTGTTGTTTTGGATACAGGG - Intergenic
1172073376 20:32275696-32275718 TTGTTGTTGTTTTTGTGAGATGG + Intergenic
1172088922 20:32413180-32413202 TTGTTGTTGTTTAAGGATGAAGG + Intronic
1172664901 20:36592335-36592357 TTGTAGTTTTTTTGGGTGGGTGG + Exonic
1172866103 20:38098852-38098874 TTATAGTTGTTTATGGTAGAGGG - Intronic
1173292053 20:41723805-41723827 TTGTTGTTGTTTTTTGGAGATGG + Intergenic
1173349718 20:42233633-42233655 TGGTAGTTGGGATGGGAAGATGG + Intronic
1173610687 20:44365176-44365198 TTGTTGTTGTTTTTGAAACAGGG + Intronic
1173698050 20:45038850-45038872 TTGTTTTTGTTTTGGGAAAATGG - Intronic
1174428706 20:50451853-50451875 TTGTATTTGTTTTGTAGAGATGG - Intergenic
1174894356 20:54433173-54433195 TGGTAGTTGTTGGGGGAGGAGGG - Intergenic
1178485631 21:33018626-33018648 TTGTTGTTGTTGTTGGAAGTGGG + Intergenic
1178528313 21:33351780-33351802 TGGTGGTTGTTTTGGAAATAGGG + Intronic
1178807529 21:35851876-35851898 TTTTATTTATTTTGGGAGGAGGG + Intronic
1179204369 21:39260584-39260606 TTGTAGTTGTTTATGGCAGAAGG - Intronic
1179223377 21:39429843-39429865 TTGTATTTGTTTTGTAGAGACGG - Intronic
1179352768 21:40628916-40628938 TTGTAATTTTTTTGGAGAGATGG + Intronic
1179464034 21:41559584-41559606 TTATATTTGTTTTGGGGGGAAGG + Intergenic
1179659932 21:42867949-42867971 TTGTAGGTGCTTTGCCAAGAGGG - Intronic
1181236998 22:21453501-21453523 TTGTATTTTTTTTGTAAAGACGG - Intergenic
1182872993 22:33664851-33664873 TTGTTGTTGTTTTTTTAAGATGG - Intronic
1182896112 22:33860802-33860824 TTCTAGTTGTTGTGGGCAGCTGG - Intronic
1183111098 22:35649098-35649120 GTGAAGTTGTTTGGGGAAGAGGG + Intronic
1183133401 22:35862417-35862439 CTGTAGTGTTTTAGGGAAGACGG - Intronic
1183404185 22:37622249-37622271 TTGTATTTTTTTTGTGGAGAAGG + Intronic
1183906874 22:41048264-41048286 ATGTAGTTGTTTTAGGATGCTGG - Intergenic
1184560514 22:45260394-45260416 TTGTATTTTTTTTGTGGAGACGG - Intergenic
1184834110 22:47010789-47010811 TTGTTGCATTTTTGGGAAGAGGG + Intronic
949880618 3:8657956-8657978 TTGGAGTTGTCGTGGGGAGAAGG - Intronic
949932574 3:9090639-9090661 TTGTTGTTGTTTTTGTGAGATGG + Intronic
950374393 3:12558322-12558344 TAGAAGGTGTTTTGTGAAGACGG + Intronic
952308251 3:32164246-32164268 TTGTTCTTGTTTTAGGAACAGGG + Intronic
952594251 3:34996775-34996797 TTGTAGTAAATTTGGAAAGAAGG - Intergenic
953239157 3:41133101-41133123 TCTTAGTTGTTTTGGGCAGATGG - Intergenic
953650331 3:44797032-44797054 TTGTTGTTGTTTTTGAGAGAGGG + Intronic
955108241 3:55921320-55921342 GTGTTGGTGTTTGGGGAAGAGGG + Intronic
956013848 3:64860256-64860278 TTTTACTTGTTTTTGGAAGGGGG + Intergenic
956894654 3:73647895-73647917 TTGTTGCTGTTTTGGGAACAGGG + Intergenic
956986360 3:74705851-74705873 TTGTTGTTCTTTTGTTAAGATGG - Intergenic
957373022 3:79320498-79320520 TTGTAGTTTTTTTGCAGAGATGG + Intronic
957517989 3:81280897-81280919 TTGTTGTTGTTTTGGAAAATTGG - Intergenic
957848898 3:85779505-85779527 TTGTTGTTGCTATGTGAAGAAGG - Intronic
959363529 3:105426823-105426845 TTGTTGTTTTTTTGGGAGGTGGG - Intronic
959515360 3:107260332-107260354 TTATAGTTGTTTTTGGCAGAAGG - Intergenic
959574784 3:107923026-107923048 TGGCAGTAGTTTTGGAAAGAAGG - Intergenic
959672294 3:108992570-108992592 TTGGATTTGTTTTTGGGAGATGG - Intronic
960369877 3:116821800-116821822 TTGTTGTTGTTTTGCAAAGCTGG - Intronic
961158720 3:124703837-124703859 TTGTTGTTGTTTTGTAGAGATGG + Intronic
961265672 3:125640344-125640366 TTGTTGTTGTTTTTGAAACAGGG - Intergenic
961600625 3:128058692-128058714 TTGTTGTTGTTTTGTAGAGATGG - Intronic
962041039 3:131707770-131707792 TTGTAGTGGTTTGAGTAAGAGGG - Intronic
963128178 3:141834310-141834332 TTTTAGGCCTTTTGGGAAGAGGG + Intergenic
964612221 3:158627042-158627064 TTGGAGTTCTTTTGGGGAGGGGG + Intergenic
964950745 3:162289627-162289649 TTATAGTTGTTTGTGGAAAAAGG - Intergenic
965190693 3:165524761-165524783 TTGTAGTTGTTTTCTCATGAAGG - Intergenic
965254640 3:166389874-166389896 GTGTTTTTGTTTTTGGAAGAGGG - Intergenic
965280549 3:166746731-166746753 TTGTAGATATCTTGGGAAAATGG + Intergenic
965469080 3:169067711-169067733 ATGTAACTGTATTGGGAAGACGG + Intergenic
965542550 3:169884411-169884433 TTGTAGTTTATTTGGGGACAGGG - Intergenic
966048001 3:175576631-175576653 TAGTACTTTTTTTGTGAAGATGG + Intronic
966294017 3:178396568-178396590 TTTTAGCTGTTTTAGGCAGAAGG + Intergenic
967024897 3:185556226-185556248 TTGTTGTTGTTTTTGAAACAGGG + Intergenic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
967461538 3:189752345-189752367 TTGTAGTTTTTTTGTAGAGATGG + Intronic
967707191 3:192664758-192664780 TTGTAGTTGTTGTTGTGAGACGG - Intronic
967945859 3:194803671-194803693 TTGTAGTTATTATTGGTAGACGG + Intergenic
969588326 4:8107313-8107335 CTGCAGATGCTTTGGGAAGATGG - Intronic
969808392 4:9628362-9628384 TTGTTGTTGTTTTGGAGACAGGG + Intergenic
970748654 4:19331347-19331369 TTGTAGATGTATAGGAAAGAAGG + Intergenic
971067823 4:23054564-23054586 TTGTAGCAGCTTTGTGAAGATGG + Intergenic
971305927 4:25481562-25481584 GTGTAGTTGTATTTGGAATAAGG - Intergenic
971415854 4:26428483-26428505 TTTTAGATGTTCAGGGAAGAGGG + Intronic
971542082 4:27831783-27831805 TAGTAGTTGTTTTGGCCTGAAGG - Intergenic
971571247 4:28213651-28213673 TTGTGGTTGTTTTGCTGAGAAGG + Intergenic
971874976 4:32296886-32296908 TTGTATTTTTTTAGGAAAGATGG - Intergenic
972898187 4:43649846-43649868 TTGTTTCTGCTTTGGGAAGATGG - Intergenic
973020631 4:45201235-45201257 TGGTAGGTGTTATGGGAAGGAGG + Intergenic
973282593 4:48375389-48375411 TAGTAGTGGTTTTGGGGAGGAGG - Intronic
974254816 4:59436473-59436495 TTATAGTTGGTATGGGGAGAAGG + Intergenic
974559555 4:63499117-63499139 TTGTAATTTTTTTGAGAATAGGG - Intergenic
974799828 4:66802287-66802309 TTTTAGTTGTTTTGGGAGATGGG - Intergenic
976319778 4:83700393-83700415 TTGTATTTTTTTTGTAAAGATGG + Intergenic
976735855 4:88308478-88308500 TTGTTGTTGTTTTGGGGACAGGG + Intergenic
977933479 4:102774621-102774643 GTGAAGGTGTTTTGGGATGAGGG + Intergenic
978163505 4:105578564-105578586 TAGTAATTGTTTTATGAAGATGG + Intronic
978451341 4:108837428-108837450 ATTTAGTTGTTGTGGAAAGAAGG + Intronic
979227076 4:118298754-118298776 TTGTGATTATTTTGGCAAGAAGG - Exonic
979355631 4:119700179-119700201 TTCTAGTTGTTTATGGATGAAGG - Intergenic
979384005 4:120042443-120042465 TTGTATATGTTTTGTGGAGACGG - Intergenic
979503046 4:121461649-121461671 TCCTAGTTATTTGGGGAAGAAGG - Intergenic
981961124 4:150540222-150540244 TTGTTGTTGTTGTTGGGAGACGG + Intronic
982220273 4:153118638-153118660 TTGTATTTTTTTAGAGAAGAGGG + Intergenic
983054797 4:163089231-163089253 CTGTAGTGGTATTGGGAAGTGGG - Intergenic
983157711 4:164371228-164371250 TTGTAGTTGTTTTGGAAATAGGG - Intronic
983670097 4:170226822-170226844 CTGTAATTATTTTAGGAAGAGGG - Intergenic
984239746 4:177204181-177204203 TTTTAGTAGGTTGGGGAAGACGG - Intergenic
984338191 4:178418937-178418959 TTGTAGCTTCTTTAGGAAGAGGG + Intergenic
985450988 4:190062292-190062314 TGGTGGTTCTTTTGGGAAAAAGG + Intergenic
986565665 5:9111274-9111296 TTGTTGTTGTTTTTAGGAGAGGG - Intronic
987141981 5:14955772-14955794 TTGTTGTTGTTTTGTAGAGATGG + Intergenic
988013396 5:25519933-25519955 TTGTAATTGTGCTGGTAAGAAGG + Intergenic
988057999 5:26125351-26125373 TTCTTTTTGTTTTGGGAAGGTGG + Intergenic
988314481 5:29605348-29605370 TTGTTTTTGTTTTGGGGAGGGGG + Intergenic
988800163 5:34689231-34689253 TTTTAATTGTTTTGTGGAGATGG - Intronic
990363488 5:55045373-55045395 TTGTTTTTGTTTTGGGGAGCAGG + Intergenic
991053465 5:62297051-62297073 CTGCAGAGGTTTTGGGAAGATGG - Intergenic
991056342 5:62324815-62324837 TTGTAATTGTTTTGGGGACTTGG - Intronic
991675616 5:69087463-69087485 TTGTATTTTTTTTGTAAAGACGG - Intergenic
992090890 5:73315871-73315893 TTGTTGTTGTTTTGGAAACAGGG + Intergenic
992606712 5:78464852-78464874 TTATAGTGGTGGTGGGAAGAAGG + Intronic
993301869 5:86221324-86221346 TCATAGTTGATTCGGGAAGAAGG - Intergenic
994183634 5:96795333-96795355 TTGTTGTTGTTTTCAGAAGGGGG - Intronic
994379934 5:99058717-99058739 TTGTAGAGGTTGTGGGAGGAAGG + Intergenic
994509403 5:100684692-100684714 TTGTGGTTCTTGTGGGAAAAAGG - Intergenic
994717585 5:103340722-103340744 TGGTAGTTGGTTTGTGATGAAGG + Intergenic
994718498 5:103352561-103352583 TTGTAGTTGTTTTTAGAAAAAGG - Intergenic
994757018 5:103806280-103806302 TTGTTGTTGTTATGGGGTGATGG + Intergenic
995470433 5:112496258-112496280 TTCTAGTTGTTTATGGAAGGTGG - Intergenic
995527866 5:113064981-113065003 TTGTTGTTGTTTTGGAGACAGGG - Intronic
996421235 5:123265206-123265228 TTGCATTTGTTGGGGGAAGAGGG - Intergenic
997120650 5:131169542-131169564 TTCTAGTTGTTCTGGGAACATGG - Intronic
997164008 5:131639235-131639257 TTGCAGTTATTCTGGAAAGATGG - Intronic
997228802 5:132228304-132228326 TTGTGGTGGTGCTGGGAAGAAGG - Intronic
997231307 5:132245394-132245416 TTATAGTTGTTTTCAGCAGAAGG + Intronic
998357088 5:141548025-141548047 TTTTAGTTGTTTTGTAAAGATGG - Intronic
999607442 5:153331476-153331498 TTGTTGTTATTTTGGGGAGGGGG - Intergenic
1000312591 5:160059611-160059633 TTGTTGTGGCTTAGGGAAGAGGG + Intronic
1003294644 6:4814528-4814550 TTGTTGTTGTTTTGGAGACAGGG + Intronic
1003655002 6:7998899-7998921 TTTTAATTGTTTTGTGGAGATGG + Intronic
1004439285 6:15632513-15632535 TGCGAGTTGTTTTGGGTAGATGG - Intronic
1004596935 6:17108576-17108598 TAGTAGTTTATTTGGAAAGAAGG + Intronic
1004888365 6:20073150-20073172 TTGTATTTTTTTTGTAAAGATGG + Intergenic
1005959148 6:30683984-30684006 TTGCAGTTTTTCTGGGGAGAAGG - Intronic
1006268876 6:32948997-32949019 TTGGAGATGATTTGGGAACAAGG - Intronic
1006319299 6:33310644-33310666 TTGTATTTTTTTTGTGGAGATGG - Intronic
1007602435 6:43090895-43090917 TTGTTGTTGTTTCTGGAAGTAGG + Intronic
1008467609 6:51848042-51848064 CTGTAGTTGTTTTGGCAGGGTGG - Intronic
1008517968 6:52335994-52336016 TGGTAGGTGCTGTGGGAAGATGG - Intergenic
1008798386 6:55335949-55335971 CTGTAGTTGTTTTTGAAACAGGG + Intronic
1008810529 6:55492365-55492387 TTTTTGTTGTTGTTGGAAGAGGG + Intronic
1009035615 6:58114511-58114533 TTGTAATTGTTTTCGGAAGGAGG - Intergenic
1009512228 6:64567840-64567862 TTCTAGTTGTTTAGAGCAGAAGG - Intronic
1009785527 6:68333410-68333432 TTGTTGTTGTTTTTGGTAGGAGG + Intergenic
1010709021 6:79150941-79150963 TTGTAGTTATTCAGAGAAGAGGG + Intergenic
1011545474 6:88477974-88477996 CTGTATTTGTTTTGTGACGAGGG - Intergenic
1011645428 6:89453128-89453150 CTGTAGTTACTTTTGGAAGAAGG - Intronic
1011731070 6:90264352-90264374 TTGTATGTGTGTTGGCAAGAGGG - Intronic
1012721155 6:102747292-102747314 TTTTAGTTGTTTCTGGAGGAAGG + Intergenic
1012829990 6:104191738-104191760 TTGTTGTTGTTTTGAGATGGAGG - Intergenic
1013698677 6:112735532-112735554 TTTTATTTGTGTTGGGTAGATGG + Intergenic
1014056920 6:117026511-117026533 GTGTTTTTGTTTGGGGAAGAGGG + Intergenic
1014700185 6:124676967-124676989 TTGTTGTTGTTTTGGGGTGGAGG + Intronic
1014867709 6:126552281-126552303 TTGTTGTTGTTTTGGGAGAGGGG + Intergenic
1015093191 6:129384290-129384312 TTGTTGTTGTTTTGGGTTGGAGG - Intronic
1015610081 6:135007768-135007790 TTCCAGTTGTTTGGGGAAGATGG - Intronic
1015888329 6:137943977-137943999 TTGTAATTTTTTTGTGGAGACGG - Intergenic
1016757844 6:147706396-147706418 TTGTAGTTTTTTAGTAAAGATGG + Intronic
1016899514 6:149087724-149087746 ATGTACTTCTTTTGGGAAGGGGG + Intergenic
1017087397 6:150726685-150726707 TTGTAGTTATTTGGTGATGAAGG - Intronic
1017471097 6:154737504-154737526 TTGTTGTTGTTTTGTAGAGATGG - Intronic
1017476633 6:154800627-154800649 TAGTAGTGGTTTTGGAAAGGAGG + Intronic
1018059388 6:160078790-160078812 TTGTGGCAGCTTTGGGAAGAGGG + Intronic
1018566435 6:165159581-165159603 ATGTAGTTTTTTTGATAAGAAGG - Intergenic
1018650034 6:165985848-165985870 TTGAAGCTGTGTGGGGAAGAAGG - Intronic
1019034647 6:169044147-169044169 TTTTCATTGCTTTGGGAAGAAGG - Intergenic
1019159682 6:170061498-170061520 TTGTTGTTGTTTTAGCAATAAGG + Intergenic
1019984138 7:4642622-4642644 TTGTTGTTTTTTGGAGAAGAGGG + Intergenic
1020442760 7:8235944-8235966 TTGTTGATGATTTGGGGAGAAGG + Exonic
1020496022 7:8854184-8854206 ATGCAGTTATTTTGGGTAGAAGG + Intergenic
1021023618 7:15636506-15636528 TTGTAGCTGTATTGGCAAGAAGG + Intronic
1021258008 7:18418170-18418192 TTTTAGTTGTTTCAGGCAGAAGG + Intronic
1021766588 7:23955992-23956014 TTATAGTCATTTGGGGAAGATGG + Intergenic
1021820537 7:24493782-24493804 TTGTAGTTGTACATGGAAGATGG + Intergenic
1022197641 7:28084279-28084301 TTGTTTTTGTTTTGGGGATATGG - Intronic
1025723857 7:64040142-64040164 TTGTTGTTATTTTTTGAAGAGGG + Intronic
1026474430 7:70722349-70722371 ATGTAGCTGCTTTGGGAAGAGGG + Intronic
1026568167 7:71507062-71507084 TTTTAGTTGTTTTGTAAATATGG - Intronic
1026594279 7:71721299-71721321 TTATTGTTGTTTTGTCAAGACGG - Intergenic
1026685465 7:72505629-72505651 TGGATGTGGTTTTGGGAAGAAGG - Intergenic
1027854304 7:83489107-83489129 GTATAATTATTTTGGGAAGATGG + Intronic
1029553746 7:101253152-101253174 TTGTAATTTTTTTGTGGAGACGG - Intergenic
1030352696 7:108507479-108507501 TTGTATTTTTTGTGGAAAGAGGG - Intronic
1030576548 7:111293497-111293519 TTATAGTAGTTTTGTGAAGGAGG - Intronic
1030827000 7:114170332-114170354 TCGTTGTTTTTTAGGGAAGAGGG - Intronic
1032199058 7:129806265-129806287 TTGTATTTGTTTTGTAGAGATGG + Intergenic
1032475771 7:132210702-132210724 TTGTAAATGTTTTGTGATGAAGG - Intronic
1033738974 7:144253769-144253791 TTTTATTTCCTTTGGGAAGAAGG - Intergenic
1033986414 7:147231152-147231174 TTGTAGTTGGATCGTGAAGACGG - Intronic
1034201014 7:149282972-149282994 TTGTTGTTGTTTTTTTAAGATGG + Exonic
1035006597 7:155667260-155667282 TTGTTGTTGTTTTGGAGACAGGG + Intronic
1035056968 7:156042193-156042215 ATGTTGTTGTTTTGGGAGGGGGG - Intergenic
1035334366 7:158116275-158116297 ATGAATTAGTTTTGGGAAGATGG + Intronic
1035699997 8:1631133-1631155 TTTTATTTGTTTTGGGGAGGAGG + Intronic
1036577642 8:10043145-10043167 TTGTTGTTGTTTTTTGGAGATGG - Intergenic
1036968679 8:13329509-13329531 CTGTAGTTGTGATGGGAAGGAGG - Intronic
1037130073 8:15398118-15398140 CTGAAGCTGTTTTGGGATGAAGG + Intergenic
1037184496 8:16046118-16046140 TTTTAATTTTTTTGTGAAGATGG - Intergenic
1037270827 8:17128606-17128628 TCGTAGTTGTTTATGGTAGAAGG - Intergenic
1037506217 8:19532286-19532308 TAATTGTTGTTTTGGGAGGAGGG - Intronic
1037661773 8:20933944-20933966 TTGTTTTTGTTTTGTGGAGACGG - Intergenic
1038285723 8:26204713-26204735 TTTCATTTCTTTTGGGAAGAGGG - Intergenic
1038651291 8:29406055-29406077 TTGTTGAGGTTTTGAGAAGATGG + Intergenic
1038903780 8:31874423-31874445 TTTTAGTTGTTTTGGGTACATGG + Intronic
1038942224 8:32317604-32317626 TTGCAATTGTTTTGGCATGAGGG + Intronic
1039414486 8:37381918-37381940 TTTTAGTTGTATTGGGGAGGAGG - Intergenic
1040466060 8:47696211-47696233 TTGTAATTTTTTTCTGAAGATGG + Intronic
1040799298 8:51323457-51323479 TTGCTGTTGTTTTGTAAAGATGG + Intronic
1041010314 8:53535861-53535883 AGGTGGTTGTTTTGGGAAGGAGG - Intergenic
1041290134 8:56300940-56300962 GTGTAGCTGTTTTGGAAAGAAGG + Intronic
1041858332 8:62482866-62482888 TTGTTGTTGTTTTTGGAGAAGGG + Intronic
1042652205 8:71055440-71055462 TTGTATGTGGTTTTGGAAGATGG + Intergenic
1043380567 8:79697666-79697688 TTGTTGTTGTTTTGTAGAGATGG + Intergenic
1043384402 8:79733623-79733645 TTGTATTTTTTTTGTAAAGATGG - Intergenic
1043963515 8:86445448-86445470 TGGTAGTTGGCTTGGGAAAATGG + Intronic
1044243857 8:89918305-89918327 TTGTTGTTGTTTTTGAGAGAGGG + Intronic
1044993276 8:97815569-97815591 TTTTTTTTTTTTTGGGAAGACGG + Intronic
1045190433 8:99876855-99876877 TTTTATTTGTTTTGGAGAGAGGG + Exonic
1045260560 8:100569778-100569800 TTTTGGTTGATTTGGGAAGAGGG - Intergenic
1045354955 8:101377937-101377959 TTGTTGTTGTTTTGAGACAAGGG + Intergenic
1046317539 8:112525714-112525736 TTGGGGTTTTTTTGGGAGGACGG - Intronic
1046686733 8:117236126-117236148 TTGTTGTTGTTTTTTGAAGGTGG + Intergenic
1046893743 8:119450659-119450681 TTATAGTTGCTTTGAGAAAATGG + Intergenic
1051343472 9:16131748-16131770 TGGTAGCTGTTTTTGGAAGCTGG - Intergenic
1051517586 9:17947926-17947948 TGGTAGTTGTTTTTGGAAGATGG - Intergenic
1051614692 9:18995907-18995929 TTGTTGTATTTTTGGTAAGATGG - Intronic
1052482413 9:29047930-29047952 TTGTTGTTGTTTTGGGAGACAGG - Intergenic
1052684147 9:31732840-31732862 TTCTAGATGTTTTAGGTAGAAGG + Intergenic
1053189937 9:36055821-36055843 TTGTTGTTGTTGAGGGGAGATGG + Intronic
1053279629 9:36810207-36810229 TCGTGGTTGTTTTGGGGTGAGGG - Intergenic
1053294347 9:36902272-36902294 TTGTCTGTGATTTGGGAAGAAGG - Intronic
1055495442 9:76850025-76850047 TTGTTGTTGTTTTGGGATTTTGG + Intronic
1055844950 9:80550596-80550618 TAGTACTTGTTTTCAGAAGAAGG - Intergenic
1056562187 9:87740468-87740490 TTGTAGGGGTTTGGAGAAGAAGG + Intergenic
1056772933 9:89492735-89492757 TTGCAGGTGTTCTGCGAAGACGG - Intronic
1057325294 9:94057926-94057948 TTCTAGTTGTTTTAGGCAGAAGG - Intronic
1057538889 9:95945796-95945818 ATATAGTTGTGTTGGGAAGATGG + Intronic
1057666001 9:97045983-97046005 TTGTTGTTGTTTGGGGAGGGTGG - Intergenic
1058166912 9:101630166-101630188 TTGTTGTTGTTCTGGGTAGGAGG - Intronic
1058166922 9:101630304-101630326 TTGTTGTTGTTTTGGGTAGGAGG - Intronic
1059073072 9:111159985-111160007 TTGTTGTTGAGTTGGCAAGATGG - Intergenic
1059294541 9:113258204-113258226 ATCAATTTGTTTTGGGAAGAAGG + Intronic
1059828965 9:118070024-118070046 TTGTAGTTGTTTTGGGCAAGAGG + Intergenic
1060629030 9:125139397-125139419 TTGTTGTTGTTTTTTAAAGACGG - Intronic
1061336394 9:129940198-129940220 TTGTTGTTGTTTTTGAGAGAGGG - Intronic
1061700500 9:132411386-132411408 TTGTTTTTGTTTTGGGGAAAAGG + Intronic
1185514363 X:688050-688072 TTGTATTTGTTTTGTAGAGAGGG - Intergenic
1185857146 X:3546523-3546545 TTTTGGTTTTTTTTGGAAGATGG + Intergenic
1186699512 X:12074924-12074946 TTGTAGCTTGTGTGGGAAGAGGG + Intergenic
1186761096 X:12722727-12722749 TCGTAGTTGAGTTGGGATGAGGG - Exonic
1187454178 X:19426642-19426664 TTGTAGTTTTTTTGCAGAGATGG - Intronic
1188845073 X:35062199-35062221 TTGTAGTTATGTTAGAAAGAAGG - Intergenic
1189080509 X:37967054-37967076 TTGTTGTTGTTTTCTGGAGATGG + Intronic
1189701331 X:43717993-43718015 GGGTAGATGTTTTAGGAAGAAGG + Intronic
1190040959 X:47071804-47071826 TTGTACTTGTTTTGTAGAGAGGG - Intergenic
1190372447 X:49755728-49755750 TTGTAGTTGTTCATGCAAGATGG + Intergenic
1192286420 X:69742896-69742918 TTCCAGTTGTTTAAGGAAGAAGG + Intronic
1193121881 X:77831762-77831784 TTTTAATTTTTTTGAGAAGACGG + Intronic
1194883864 X:99288353-99288375 TTGTGGTTACTTTGGGGAGAAGG + Intergenic
1195203664 X:102573869-102573891 TTTTGGTTGTTTTTGGCAGAGGG - Intergenic
1195288143 X:103405209-103405231 CTGTGGTTGTTATGGGACGATGG + Intergenic
1195530577 X:105950696-105950718 ATGTAGGTGTTTTGGGACTAAGG + Intronic
1195530636 X:105951780-105951802 ATGTAGGTGTTTTGGGACTACGG + Intronic
1196629809 X:117925858-117925880 TTGTTGTTGTTTTGTAGAGAAGG + Intronic
1196670496 X:118361571-118361593 TTTTAATTTTTTTGAGAAGATGG - Intronic
1196754595 X:119147168-119147190 TTGCAGATGCTATGGGAAGATGG + Intronic
1197033123 X:121842785-121842807 TTATAATTGTATTTGGAAGATGG - Intergenic
1197493324 X:127146763-127146785 TTCTTGTTGTTTTGGGCAGATGG - Intergenic
1198206320 X:134468440-134468462 TTGTATTTTTTTTGTAAAGACGG - Intronic
1198467814 X:136919106-136919128 TTGTAGTTCATTTGGGTATAAGG - Intergenic
1198536399 X:137590890-137590912 TTGGGTTTGTTTTGGGGAGATGG + Intergenic
1199179739 X:144839494-144839516 TTGTTGTTGTTTTGATAAAAAGG - Intergenic
1199583528 X:149386234-149386256 TTTTAGTTGTTTTAGAAAGGAGG - Intergenic
1200302792 X:154995288-154995310 TTATAGCTGTCTTGGGGAGAGGG + Intronic
1201478737 Y:14413870-14413892 TTGTTGTTGTTTTGGTAGGGGGG - Intergenic