ID: 1106597399

View in Genome Browser
Species Human (GRCh38)
Location 13:31158085-31158107
Sequence TTCAGGTTACTTAGTAATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 169}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106597399_1106597401 23 Left 1106597399 13:31158085-31158107 CCTTAATTACTAAGTAACCTGAA 0: 1
1: 0
2: 0
3: 11
4: 169
Right 1106597401 13:31158131-31158153 TTAGAAGTTCCTTCTATAAAAGG 0: 1
1: 0
2: 1
3: 20
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106597399 Original CRISPR TTCAGGTTACTTAGTAATTA AGG (reversed) Intronic
902997972 1:20242347-20242369 TTCAGTTTACTAATTAATTTGGG - Intergenic
905715523 1:40146076-40146098 TTAAGGTAAATTAGTAATTTGGG + Intergenic
907591491 1:55676503-55676525 TTTAGGTTCCTTAGAGATTATGG + Intergenic
909193819 1:72590411-72590433 TTCAGCTTAATCAGTATTTAAGG + Intergenic
912027202 1:105191709-105191731 TTCAAGTTACTTAGTTATTCAGG + Intergenic
915507253 1:156365871-156365893 TTGAGGTTACTGAGTAACTTGGG - Intronic
916816794 1:168362071-168362093 TTATGGTTACTGAGTACTTAGGG - Intergenic
924496805 1:244598391-244598413 TTCTGGTTTCTAAGTAAATAAGG + Intronic
1063759654 10:9058437-9058459 TTCATGTAAATTAGAAATTATGG + Intergenic
1064017331 10:11782659-11782681 TTTTGATTACTTAGGAATTATGG - Intergenic
1064291090 10:14034646-14034668 CTCAGGTTATTTATTGATTAGGG - Intronic
1064310183 10:14205503-14205525 CTCAGGTTATGTAGAAATTATGG + Intronic
1065051056 10:21792454-21792476 TCAAGGTTAGCTAGTAATTATGG - Intronic
1069687065 10:70325104-70325126 TTCAGGTTACTCAGCATTTCTGG - Intronic
1070432522 10:76355373-76355395 ATCAGGTTACCAAGAAATTATGG + Intronic
1072439868 10:95444892-95444914 TTTAGGTTAGTTTGTAAGTAAGG - Intronic
1072467497 10:95679888-95679910 TTCATTTTACTTAGAAATGACGG - Intronic
1072494231 10:95939725-95939747 TTCAGTTTCATTAGTCATTAGGG - Intergenic
1072823919 10:98586543-98586565 TTATGGTTACTTTCTAATTATGG - Intronic
1073257601 10:102163716-102163738 ATCAGGTTATTTAGCAAGTATGG - Exonic
1073264886 10:102220946-102220968 CTCAACTTTCTTAGTAATTAAGG - Intergenic
1074209316 10:111314861-111314883 TTTAGGTTTCTTATTAATTCTGG - Intergenic
1074475138 10:113766296-113766318 TTCAGATTATTCAGTAGTTATGG - Intronic
1076019843 10:127063796-127063818 GTCAGATTACTTAGTGACTAGGG + Intronic
1077646099 11:3926199-3926221 TTCAGGGTACTTATAAATTATGG - Intronic
1079581570 11:22071014-22071036 TACTGGTTACTTAGGCATTATGG - Intergenic
1080303567 11:30812677-30812699 GGAAGGTTACTTGGTAATTAAGG - Intergenic
1080357161 11:31462710-31462732 TTCAAGTTACTTACTAACTGTGG + Intronic
1080943677 11:36947420-36947442 TGCAGTTTACTTTGAAATTAGGG + Intergenic
1086721303 11:90124703-90124725 TTCAGGTCCCTTAGAAATGAAGG + Intergenic
1087185864 11:95194272-95194294 CTCAGGTTACCTAGTAATGGGGG - Intronic
1088960507 11:114659037-114659059 TTCTGGTTACTTGGTGCTTAAGG - Intergenic
1091401379 12:182580-182602 TTGAGGTCACTTAGTCCTTAGGG - Intergenic
1094200337 12:27788522-27788544 TTCATGTTACTTAGCTTTTAGGG + Intronic
1095610172 12:44118951-44118973 TTTAGGTTATTTAGGAATTGGGG - Intronic
1098169586 12:67733190-67733212 TGAAGGTTACTTTGTAGTTAGGG - Intergenic
1099214236 12:79834846-79834868 TTCAGGTTGCTAGGTAATTGAGG - Intronic
1102283795 12:111638729-111638751 TTCAGTTCACTTAGTAAGTGTGG + Intergenic
1105543899 13:21338071-21338093 TTCAGGTTTCTTTGAAATCAAGG + Intergenic
1106597399 13:31158085-31158107 TTCAGGTTACTTAGTAATTAAGG - Intronic
1108233584 13:48376781-48376803 TTGTGGTTACCTAGTTATTATGG + Intronic
1108410482 13:50141481-50141503 TTTAGGTTGCTTTGTATTTAAGG + Intronic
1110059191 13:71020016-71020038 TTCTGGTTCCTTAATATTTAGGG - Intergenic
1110559326 13:76893471-76893493 TTTAGGTTACTTAGAAAGAAGGG + Intergenic
1112182375 13:97096427-97096449 TTCAACTTATTTAGTAATCATGG - Intergenic
1112667423 13:101591854-101591876 TTCATGTTTATTAGGAATTATGG + Intronic
1113715060 13:112498379-112498401 TTCAGGCTACTATGTATTTAAGG - Intronic
1117851885 14:59981405-59981427 ATCAGGTAATTCAGTAATTACGG - Intronic
1118551256 14:66953066-66953088 TTCAGCATCCTTAGTCATTAGGG - Intronic
1119489464 14:75018299-75018321 TGCAGGTTGCTGGGTAATTAGGG + Intronic
1120202352 14:81551680-81551702 TTCAGCTTCATTAGTCATTAAGG + Intergenic
1121303916 14:92893319-92893341 TTCAGGTTACTTTCTCATAAAGG - Intergenic
1121741446 14:96255054-96255076 TTCCTGTTACTTAGTAATGTAGG - Intronic
1124386364 15:29211087-29211109 TTCAGGTTACTACATAATAATGG + Intronic
1124812240 15:32952805-32952827 CTCAGGTTATTTAGTAATAAGGG + Intronic
1126631085 15:50736870-50736892 TTCAGCTTAGTAAGTAATTCAGG - Intronic
1126954664 15:53919192-53919214 GGCAGGTTACGTAATAATTATGG + Intergenic
1130762813 15:86838161-86838183 TTTAGGTTACAGAGCAATTAGGG - Intronic
1131785868 15:95910804-95910826 CACAGGTTACTAAGTAAATAAGG + Intergenic
1133553042 16:6876931-6876953 TTCAAGTTTCTCAGTATTTATGG + Intronic
1137303229 16:47174150-47174172 TTCAGGTTATGTTGTAATTTAGG + Intronic
1137967018 16:52945335-52945357 TTCAATTTCCTTACTAATTATGG - Intergenic
1139518933 16:67468757-67468779 TTCAGGGCCCTTAGTAAATAAGG - Intronic
1140631892 16:76863676-76863698 TTCAGGAAACTTAACAATTATGG + Intergenic
1145290151 17:21537156-21537178 TTCAGTCTTCTTAGTATTTACGG - Intronic
1145291824 17:21552763-21552785 TTCAGATTTCTTAGTAGTAAAGG + Intronic
1146536545 17:33657563-33657585 TTCAGGTTGCTCTGTAATTGGGG - Intronic
1147860068 17:43514509-43514531 TTCTGGTTTTTTGGTAATTATGG + Intronic
1153879549 18:9408458-9408480 TTCAGGATTGTTAGTAAGTAGGG + Intergenic
1155509815 18:26565168-26565190 GTCAGATTACTGTGTAATTAGGG + Intronic
1158929380 18:62307837-62307859 TTCAGCTAAATTAGTAATTATGG - Intergenic
1159873787 18:73787954-73787976 CTCAGGTGAGTTAGTAATTCAGG - Intergenic
1165986368 19:39772423-39772445 TTCCGGTTACTTTTTAAATAAGG - Intergenic
927665000 2:25025529-25025551 TTCAGCTGACTTTGTAATTTTGG - Intergenic
928219629 2:29392933-29392955 TCAAGGTTACTGAGTATTTAAGG + Intronic
931016501 2:57987406-57987428 TTCAAGATCATTAGTAATTAGGG + Intronic
934094137 2:88583176-88583198 TTCAAGTAACTTAGTTATTTAGG - Intronic
935686053 2:105683968-105683990 TTCAGGTGACTCAGAAATCATGG - Intergenic
939131286 2:138238423-138238445 TTGTTGTTACTTAGTAATTTTGG + Intergenic
940043305 2:149383597-149383619 TTCATCTTACTGAGTCATTATGG + Intronic
941158277 2:162004620-162004642 TTCAGCTTACTTAATGAGTAAGG - Intronic
941980403 2:171449325-171449347 TACAGGTTAGTTACTTATTAGGG - Intronic
942974385 2:181997372-181997394 GTCAGGTTACTTAGTGGATATGG - Intronic
943751846 2:191517353-191517375 TTCAGACAACTTAGTAATTTGGG + Intergenic
945046324 2:205784918-205784940 GCCAGGTCTCTTAGTAATTACGG + Intronic
947938957 2:234031932-234031954 TTCATGCTTCTTAGTAATTTTGG + Intergenic
1169349164 20:4854423-4854445 TTCAAGTTTATTAGTCATTAGGG + Exonic
1170870786 20:20204234-20204256 TTCTGGTTGCTTATTAATGATGG + Intronic
1178721334 21:35012492-35012514 TTCAGGTTTCTGAATCATTAAGG + Intronic
1179425069 21:41270075-41270097 TTCAGGATTATTAGTCATTAGGG - Intronic
1184962048 22:47937239-47937261 TTCAGTTTTCTTAATAGTTATGG - Intergenic
951106003 3:18743886-18743908 TTTAGGTCACTTGGAAATTATGG - Intergenic
951129084 3:19020156-19020178 CTTAGGTTACTTACTAATAATGG - Intergenic
951480629 3:23158840-23158862 TTCAGTTTACTTTGTAATGTTGG - Intergenic
951717972 3:25669073-25669095 TTCAGGGTTCTCAGTAATTCAGG + Intergenic
953036489 3:39216116-39216138 TTCAGCCTATTTAGTAATTGGGG + Intergenic
953446347 3:42971669-42971691 TGCAGGTTATTTAGTAGGTAAGG - Intronic
953937858 3:47061540-47061562 TTCAATCTATTTAGTAATTAGGG + Intronic
956458476 3:69447315-69447337 TTCTGGTTATTTACTCATTATGG - Intronic
956841459 3:73143849-73143871 TTTAGTTTATTTTGTAATTAAGG + Intergenic
957407823 3:79794590-79794612 TTCAGTTTACTTACTCATTAAGG - Intergenic
957407831 3:79794830-79794852 TTCAGTTTACTTACCCATTAAGG - Intergenic
958136077 3:89493963-89493985 TATAGTTTACTTAGTGATTATGG - Intergenic
958509000 3:95021414-95021436 TTCAGTTTAGTTACTCATTATGG + Intergenic
958891347 3:99786585-99786607 TGCAGGTGTCTTAGTCATTAGGG - Intronic
960197987 3:114794280-114794302 TTCAGATTTTTTATTAATTAAGG + Intronic
960221437 3:115114273-115114295 TTCAGGTTACTTAGATATAATGG + Intronic
961577272 3:127847849-127847871 TTCAGGATATTTACAAATTAAGG + Intergenic
962560703 3:136603544-136603566 TGCAGAATACTTAGTATTTATGG + Intronic
964275832 3:155007987-155008009 ATCCTGTTACTAAGTAATTAGGG - Intergenic
967167819 3:186799051-186799073 CCCAGGCTTCTTAGTAATTAAGG + Intronic
970269039 4:14323201-14323223 TTCTGGTTTCTGAGTAATTTTGG - Intergenic
970868642 4:20787217-20787239 TTCATGTTTCATAGTAATAAGGG + Intronic
972443764 4:39122932-39122954 TTTTGGTTCCTTAGTATTTAGGG + Intronic
972504640 4:39709005-39709027 TTAAGTTAGCTTAGTAATTAAGG + Intronic
973153037 4:46911852-46911874 TTAAGGATACTTACTAATAAAGG - Intergenic
976665770 4:87589411-87589433 TTCTTGTTACTAAGAAATTATGG + Intergenic
976768549 4:88624459-88624481 TTCAAGTTCATTAGTCATTAAGG - Intronic
980452273 4:132989690-132989712 ATCAGGTTACATAGTTTTTATGG + Intergenic
983828082 4:172289428-172289450 TTCATGTTATCTGGTAATTATGG + Intronic
985497838 5:219403-219425 TTAAAATTACTTTGTAATTAAGG - Intronic
986894914 5:12353931-12353953 TTCAGCTTCCTTAGAATTTACGG + Intergenic
988133838 5:27142270-27142292 ATGAGGTTAATTAGGAATTAAGG - Intergenic
988294600 5:29339556-29339578 TTCTGGTTACTTAATAAAAATGG + Intergenic
992106993 5:73457650-73457672 TTCAGTTTACTTATTTCTTATGG - Intergenic
995201713 5:109432721-109432743 TTCAATTTATTTAGTAGTTATGG - Intergenic
996434418 5:123418980-123419002 TTCATGTTTCTTATGAATTATGG - Intronic
997154962 5:131545691-131545713 TTCAGTTAACTTAGAAAATATGG - Intronic
997440893 5:133907914-133907936 TTCAGGCTATTTAGAAATAAAGG - Intergenic
998523255 5:142819241-142819263 TTCAGGGGAATTTGTAATTAGGG - Intronic
998577943 5:143337260-143337282 CTCAGCTTAATTAGTAATCAGGG + Intronic
1000357471 5:160413953-160413975 TTTGCGGTACTTAGTAATTATGG + Exonic
1000389587 5:160709446-160709468 TTCAGCTTAACTAGTAATCAGGG + Intronic
1003408193 6:5840317-5840339 TTCAGGTTTCTTTGAAATCAAGG - Intergenic
1003985800 6:11433914-11433936 TTCACTATACCTAGTAATTATGG - Intergenic
1005094653 6:22101554-22101576 TTTAGGTTATATAGTACTTATGG + Intergenic
1008914708 6:56774637-56774659 TTCAGGGTATTCTGTAATTATGG - Intronic
1010227319 6:73502991-73503013 TTAAAGTTTCTTAGTAATGAAGG + Intronic
1010693299 6:78936876-78936898 TTCAGATCACTTGGAAATTAGGG + Exonic
1012420873 6:99063792-99063814 TTTAGGATACCTAGTAATTCTGG - Intergenic
1012579664 6:100851669-100851691 TGCAGGAGAGTTAGTAATTAGGG - Intronic
1014796614 6:125732131-125732153 TTCTGTTTATTGAGTAATTAGGG + Intergenic
1017478794 6:154828465-154828487 TTCAGTTTCTTTAGTATTTATGG + Intronic
1017537571 6:155364590-155364612 TTCAAGTTGCTTATTAATTATGG - Intergenic
1017798716 6:157872076-157872098 TTCAGATTATTAACTAATTAGGG + Intronic
1020227995 7:6295298-6295320 TTCAGGTTAATTATTTATAATGG + Intergenic
1021847281 7:24775243-24775265 TTCAGATTTCTTAGTAACTCAGG + Intergenic
1022897620 7:34767755-34767777 TTCAGGTTATTTAAGAATTTTGG - Intronic
1024125150 7:46286998-46287020 TTCATTTTACTGAGTAATTGTGG + Intergenic
1027514986 7:79130390-79130412 TTCAGGTTTCTTAGAAAATATGG - Intronic
1028453665 7:91015205-91015227 ATCAGTTTTCTTACTAATTAAGG + Intronic
1029123546 7:98283170-98283192 TTCAGATTGCTTAGAAAGTAGGG + Intronic
1030869844 7:114741789-114741811 TTCAGATGAATTAGCAATTAGGG - Intergenic
1030914452 7:115295350-115295372 TTCAGAATACTTAGCAAATAGGG - Intergenic
1031894366 7:127331427-127331449 TTCAAGTTTCTAAGTAATTAAGG + Intergenic
1036821637 8:11944555-11944577 TCCAGGATACTTATTAATGATGG - Intergenic
1037135326 8:15453308-15453330 TTCATTTTATTTAGTAATTTAGG - Intronic
1041591599 8:59592415-59592437 TTCAGGTTTGTTTGTAATGATGG - Intergenic
1043584676 8:81754548-81754570 TTTAGGCTACTTAATAATGAGGG + Intronic
1046746032 8:117877076-117877098 TTCAAGGTACTCAGTCATTAGGG - Intronic
1048072294 8:131034638-131034660 TCCAGGTTACTTAGTGCTCAAGG - Intronic
1050070457 9:1806524-1806546 TTTAGCTTAATTAGTCATTAGGG - Intergenic
1051770288 9:20570707-20570729 TTCAAATTACTTAGAAATTCTGG + Intronic
1055931237 9:81561788-81561810 TTCTGCTTATTAAGTAATTAGGG - Intergenic
1058312492 9:103521542-103521564 TACATGTTAATTGGTAATTAAGG + Intergenic
1058624195 9:106917323-106917345 TTCAGGTTACTTTTTATTTTAGG - Intronic
1059906825 9:118996081-118996103 TTAAGGTGACTTAGCAGTTAAGG - Intergenic
1061344669 9:130013362-130013384 TTTAGCTTAATTAGTAATCAGGG + Intronic
1186362000 X:8852108-8852130 TTCTGGTAGCATAGTAATTAAGG - Intergenic
1188276155 X:28203866-28203888 TTCAGGTTACTTAGTCAGCTAGG - Intergenic
1188591857 X:31846476-31846498 TTAAGGATAGTTATTAATTATGG + Intronic
1188932506 X:36129988-36130010 TTCAGCATAATTAGTAATTTGGG + Intronic
1189225206 X:39407019-39407041 TTCAGGGTACTCAGTTATTAGGG - Intergenic
1190027336 X:46936629-46936651 TTCAGTTTCCTTAGTAGTTATGG + Intronic
1190852146 X:54255722-54255744 TTCAGGTCAGTTTGTAAATATGG - Exonic
1192779560 X:74280376-74280398 TTAAGGTAACATAGTGATTAAGG - Intergenic
1194651181 X:96516388-96516410 TTAATGTTACTTTGTCATTATGG - Intergenic
1194704565 X:97159766-97159788 TTTAGATTACTTAGTAAAAACGG + Intronic
1195497148 X:105549809-105549831 TTCAGGTCTCTGAGTAATTCTGG - Intronic
1198954998 X:142119379-142119401 TTCATGATACTTACTAATAAAGG - Intergenic
1199118317 X:144018971-144018993 CTAATGTAACTTAGTAATTAAGG - Intergenic