ID: 1106600320

View in Genome Browser
Species Human (GRCh38)
Location 13:31181748-31181770
Sequence TCTCTTAGATATGGCTCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106600313_1106600320 26 Left 1106600313 13:31181699-31181721 CCCAAATCAGTAAAGTGGGCATT No data
Right 1106600320 13:31181748-31181770 TCTCTTAGATATGGCTCCAGAGG No data
1106600312_1106600320 29 Left 1106600312 13:31181696-31181718 CCTCCCAAATCAGTAAAGTGGGC No data
Right 1106600320 13:31181748-31181770 TCTCTTAGATATGGCTCCAGAGG No data
1106600317_1106600320 -3 Left 1106600317 13:31181728-31181750 CCTCGAGGCCTTTATGAATGTCT No data
Right 1106600320 13:31181748-31181770 TCTCTTAGATATGGCTCCAGAGG No data
1106600314_1106600320 25 Left 1106600314 13:31181700-31181722 CCAAATCAGTAAAGTGGGCATTT No data
Right 1106600320 13:31181748-31181770 TCTCTTAGATATGGCTCCAGAGG No data
1106600310_1106600320 30 Left 1106600310 13:31181695-31181717 CCCTCCCAAATCAGTAAAGTGGG No data
Right 1106600320 13:31181748-31181770 TCTCTTAGATATGGCTCCAGAGG No data
1106600316_1106600320 -2 Left 1106600316 13:31181727-31181749 CCCTCGAGGCCTTTATGAATGTC No data
Right 1106600320 13:31181748-31181770 TCTCTTAGATATGGCTCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106600320 Original CRISPR TCTCTTAGATATGGCTCCAG AGG Intergenic