ID: 1106602572

View in Genome Browser
Species Human (GRCh38)
Location 13:31200268-31200290
Sequence GGACGGCGGGACGCGCGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 1, 2: 0, 3: 13, 4: 184}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106602572_1106602586 29 Left 1106602572 13:31200268-31200290 CCGGCGCGCGCGTCCCGCCGTCC 0: 1
1: 1
2: 0
3: 13
4: 184
Right 1106602586 13:31200320-31200342 GCCCTCTCGCGGCGCCCAGGTGG 0: 1
1: 0
2: 0
3: 8
4: 111
1106602572_1106602584 18 Left 1106602572 13:31200268-31200290 CCGGCGCGCGCGTCCCGCCGTCC 0: 1
1: 1
2: 0
3: 13
4: 184
Right 1106602584 13:31200309-31200331 CCGTCAGCAGCGCCCTCTCGCGG 0: 1
1: 0
2: 1
3: 0
4: 74
1106602572_1106602588 30 Left 1106602572 13:31200268-31200290 CCGGCGCGCGCGTCCCGCCGTCC 0: 1
1: 1
2: 0
3: 13
4: 184
Right 1106602588 13:31200321-31200343 CCCTCTCGCGGCGCCCAGGTGGG 0: 1
1: 0
2: 1
3: 9
4: 82
1106602572_1106602585 26 Left 1106602572 13:31200268-31200290 CCGGCGCGCGCGTCCCGCCGTCC 0: 1
1: 1
2: 0
3: 13
4: 184
Right 1106602585 13:31200317-31200339 AGCGCCCTCTCGCGGCGCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106602572 Original CRISPR GGACGGCGGGACGCGCGCGC CGG (reversed) Intronic
900077342 1:827932-827954 ACACGGCGTGACGCGCGCTCGGG + Intergenic
900180242 1:1308046-1308068 TGACAGCGGGCGGCGCGCGCGGG - Intronic
900314428 1:2050032-2050054 GGACGGCGGGGCCCTCGGGCTGG + Intergenic
900369673 1:2326025-2326047 GGACGGCGGGAGGAGGCCGCGGG - Intronic
901007608 1:6179551-6179573 CGGCGGCGGGACGCGAGCGCGGG + Intronic
901762585 1:11480184-11480206 GGACAGCGGGAAGCTGGCGCCGG - Intronic
903349755 1:22710716-22710738 GGGGGCCGGGACGCGCGCGGGGG + Intergenic
906204333 1:43979171-43979193 GGCCGCGGGGGCGCGCGCGCGGG + Intronic
906640549 1:47438369-47438391 GGACGGCGAGCCCCGCGCTCTGG + Exonic
906805567 1:48776563-48776585 GGACGGTGGGACCCGGGCGGGGG - Intronic
912439553 1:109687927-109687949 GGACGGTGGGACGAGGGCGCAGG + Intronic
913222063 1:116667636-116667658 GGACGGTCCGACGCGCGCGGAGG - Exonic
921046118 1:211479138-211479160 GAAGGGCGAGATGCGCGCGCGGG + Exonic
923744337 1:236686568-236686590 GGGCGGCGGGCGGCGGGCGCGGG - Exonic
924524734 1:244835767-244835789 GGTCGGCGGGGCGCGCGCCGCGG + Intronic
924527230 1:244863571-244863593 GCGCGGCGGGAGGCCCGCGCGGG - Intronic
924754795 1:246931517-246931539 GGAGGGCGGGTCGCGCGGCCTGG - Intronic
1062874219 10:931982-932004 GGACGGCGGGCGGGGCGGGCGGG - Intergenic
1065099087 10:22316259-22316281 GGGGCGCGGGACCCGCGCGCGGG + Exonic
1067227424 10:44385094-44385116 CGGCGGTGGGAGGCGCGCGCCGG + Intronic
1072710577 10:97713589-97713611 GGAAGCCGGGAGGAGCGCGCGGG + Intronic
1075430404 10:122375136-122375158 GGAGGGCGGGAGGCCCGCGGCGG + Intronic
1076401908 10:130190362-130190384 ACACGGCGGGGCGCGCGCTCCGG - Intergenic
1076683545 10:132186982-132187004 GGGCGGGGGGACGCGTGAGCCGG - Exonic
1076850029 10:133088160-133088182 GGGCGGCGGGAGGGACGCGCGGG + Intronic
1076878783 10:133230188-133230210 GGACGGAGGGACGGCGGCGCGGG + Intergenic
1077051530 11:568913-568935 GGCCCGCGGGACGCGGGTGCGGG - Intergenic
1077410318 11:2400815-2400837 GGAGGACGGGCCGCGCGGGCCGG + Intronic
1080283902 11:30586450-30586472 GGACTGCGGGAGGGGCGTGCAGG - Intronic
1082789261 11:57335837-57335859 GGACGCGGGGCCGCGCACGCGGG - Exonic
1083145794 11:60757494-60757516 GGACAGCGGGAGGCGGGCGGGGG + Intronic
1089207112 11:116773103-116773125 GGCCACCGGGACGCGCTCGCAGG + Intergenic
1089966159 11:122656246-122656268 CGAGGGCCGGCCGCGCGCGCGGG - Intronic
1090699072 11:129278909-129278931 GGAGCGCGGGGCGCGGGCGCGGG + Intronic
1090788593 11:130070397-130070419 GGAGGGCGGGGCGGGCGCCCGGG - Intronic
1094607306 12:31959670-31959692 GGACGGCGGGACGCGCGAGCCGG - Intronic
1096668220 12:53181012-53181034 ACGCGGCGGGACGCGCGGGCAGG - Intronic
1097281248 12:57846472-57846494 GGACGGGCGGGCGCGCGGGCTGG + Exonic
1102687473 12:114735893-114735915 TGACGTCGGGCAGCGCGCGCGGG + Intergenic
1104929363 12:132329750-132329772 GGACGGGGGGCGGGGCGCGCGGG + Intergenic
1105389206 13:19959183-19959205 GGACGGCGGGACGGCGGGGCGGG + Intronic
1105389209 13:19959191-19959213 GGACGGCGGGGCGGGGGTGCCGG + Intronic
1106269256 13:28138373-28138395 GGACGACGGGGTGAGCGCGCGGG - Intergenic
1106602572 13:31200268-31200290 GGACGGCGGGACGCGCGCGCCGG - Intronic
1107851542 13:44576981-44577003 GGGCGGCGGGACGTGCGCTAGGG + Intronic
1113379124 13:109786780-109786802 GGACGGCGGGAAACGCGGCCCGG - Intergenic
1113655769 13:112067158-112067180 GGGCGGCGCGCCGCGTGCGCTGG - Intergenic
1122275122 14:100587208-100587230 GGAGGGCAGGGCGCGGGCGCGGG - Intronic
1128149786 15:65355644-65355666 GGGGGGCGGGACGCCCGCGTCGG - Intronic
1128153231 15:65376602-65376624 GGACGGGGGGAGGGGGGCGCGGG - Intronic
1128454212 15:67823526-67823548 GCACGGCTGTGCGCGCGCGCGGG + Intronic
1128987432 15:72231345-72231367 CGGCGGCGGAACGCGCGGGCAGG + Exonic
1129663360 15:77565661-77565683 GGAAGGAGTGACGCGCGCGCTGG - Intergenic
1132593496 16:737308-737330 GGACGGCGGGACCCGGAGGCTGG - Exonic
1135023837 16:18984134-18984156 GGGCGGCAGGGAGCGCGCGCGGG + Intronic
1136146741 16:28320735-28320757 CGACGGCGGGGGGCGCGGGCCGG - Exonic
1136620940 16:31427993-31428015 GGTACGCGGGACGGGCGCGCGGG - Exonic
1136913003 16:34159577-34159599 GGTCGGCGTGCAGCGCGCGCAGG + Intergenic
1137285645 16:47014003-47014025 GGTCTGCGGGACGCGCGGGCGGG - Intergenic
1137454809 16:48610087-48610109 GGGCGGCGGGGCGCGGGCGGGGG - Exonic
1139529889 16:67537842-67537864 GGGCGCCGGGACGCCCGGGCCGG + Intronic
1139954359 16:70686134-70686156 GGAGGGCGGGCCGCGCGGGAGGG + Intergenic
1140209571 16:72959825-72959847 GGGTGGCGGGGGGCGCGCGCTGG + Exonic
1141116613 16:81315018-81315040 GGCCGGGCGGGCGCGCGCGCAGG + Exonic
1141886496 16:86895827-86895849 GGACGGCGGGATGGGCACGGTGG + Intergenic
1142230950 16:88900083-88900105 GGACGGCGGGCCCAGCGTGCAGG - Intronic
1142596370 17:1031839-1031861 GGAGGGAGGGAGGCGAGCGCGGG - Intronic
1142664731 17:1456150-1456172 GGCCGGAGGGGCGCGCGCGGCGG - Exonic
1143174771 17:4949609-4949631 GGAGGGCGGGACGGGCGGGACGG + Intronic
1143321181 17:6070298-6070320 GGGCGGCGGGAGGTGCGCACCGG + Intronic
1143321215 17:6070428-6070450 GAACGGCGGGGCGGGCGGGCGGG - Intronic
1144759690 17:17700399-17700421 GGGCGGCGGGGCGCGGCCGCTGG - Intronic
1144953022 17:19004204-19004226 GGAGGGCGGGCCGCGCGGGGAGG + Intronic
1146256011 17:31391851-31391873 GGATGGCGGGCGGCGCGGGCTGG + Exonic
1146646876 17:34581760-34581782 GGGCCGCGGGCCGCGCGCGGAGG + Intronic
1147015643 17:37489755-37489777 GGGCGGGGGGACGCGCGGGGCGG - Intergenic
1148646993 17:49224983-49225005 GGACGGCAGGATGGCCGCGCAGG - Exonic
1149490970 17:57085137-57085159 GGCCGGCGGCGCGCACGCGCAGG + Intronic
1153872645 18:9334807-9334829 GGACGGCGGGAGGCGCGGCCTGG + Exonic
1157386145 18:47261187-47261209 GGACGGCGGGCGGCGGGCGGCGG - Intergenic
1157464207 18:47930538-47930560 GGCCGGCGGCCCGGGCGCGCGGG + Exonic
1157610101 18:48950608-48950630 GGAGGCCGGGGCGCGCGCGGGGG + Exonic
1157815868 18:50729222-50729244 GTACAGCGCGACCCGCGCGCGGG + Exonic
1160163968 18:76494882-76494904 GGGCGGCGGGGCGAGCGCCCGGG - Intronic
1160909845 19:1469388-1469410 AGACGGCGGGCAGCGCGGGCCGG - Exonic
1161293086 19:3506269-3506291 GGCCGGCCGGGCGCGCGCGGCGG + Intronic
1163314970 19:16535539-16535561 GGCCGGCGGGATGGGCGCGGCGG + Exonic
1165213727 19:34254708-34254730 AGACGGCGAGACGGGCCCGCGGG + Intronic
1165431407 19:35775548-35775570 GGAGGGCGCGAGCCGCGCGCGGG - Intronic
1165888950 19:39099170-39099192 GGACGGTGGGGGGCGCGCGCAGG + Intronic
1166797979 19:45439675-45439697 GGGCGTCGGGACGCGTCCGCCGG - Intronic
1167268282 19:48493972-48493994 GGCCGGCGGGGCGGGAGCGCCGG - Exonic
1168003398 19:53467239-53467261 GGTGGGAGGGATGCGCGCGCGGG - Intergenic
925169840 2:1743911-1743933 GGGCGGCGGGAGGCGAGCGGGGG + Intronic
926095790 2:10080112-10080134 GGAGGGCGGGACCCGCCGGCGGG - Exonic
927714119 2:25341640-25341662 GGACGGCGGGCCGGGCTGGCCGG - Intronic
928093562 2:28391010-28391032 GGGCAGGCGGACGCGCGCGCCGG - Intergenic
931291947 2:60881397-60881419 GGCCGGCGGGGAGCGTGCGCGGG + Intergenic
931321343 2:61177310-61177332 GGACGCGGGGACGCGCGGGCGGG - Intergenic
933658276 2:84906362-84906384 GGAGAGCGGGAAGCGGGCGCTGG - Intronic
942116730 2:172735769-172735791 GGGGGGCGGGACGCGGGTGCGGG - Intronic
942450818 2:176107102-176107124 TGGCGCCGAGACGCGCGCGCTGG - Intronic
946019859 2:216633613-216633635 CGGCGGCGGGGCGCGCGCGGAGG + Exonic
946412696 2:219522946-219522968 GGGCGGCGAGGCGCGCGAGCCGG + Intronic
946966471 2:225042403-225042425 GACCGGCGGGAGGCGCGCCCCGG - Exonic
947593055 2:231395921-231395943 GGCCGGCGCGGCGCGCGCGGGGG - Intronic
947729183 2:232418773-232418795 GGAGGGAGGGACGCGCCGGCGGG - Intergenic
948115823 2:235493979-235494001 GGCAGGCGGGGCGCGGGCGCGGG + Intergenic
948801600 2:240435798-240435820 GGACCGCGAGCCGCGCGCGCCGG + Exonic
1169208152 20:3751478-3751500 GGACGGGGGGACGCGGGTGAAGG - Intronic
1171012790 20:21517609-21517631 GGACGCCGGGAGGCCTGCGCAGG + Intergenic
1172848419 20:37944171-37944193 GGGCGGCGGGGCGGGCGCGGCGG - Exonic
1176281653 20:64316843-64316865 GGACGCTGGGAGGCGCGCGTGGG + Intergenic
1176547183 21:8207087-8207109 GGCCGGTGTGACGCGTGCGCCGG + Intergenic
1176549555 21:8215143-8215165 GGACGGCGGAGCGAGCGCACGGG + Intergenic
1176555088 21:8251296-8251318 GGCCGGTGTGACGCGTGCGCCGG + Intergenic
1176557446 21:8259372-8259394 GGACGGCGGAGCGAGCGCACGGG + Intergenic
1176566134 21:8390134-8390156 GGCCGGTGTGACGCGTGCGCCGG + Intergenic
1176568480 21:8398177-8398199 GGACGGCGGAGCGAGCGCACGGG + Intergenic
1176574008 21:8434320-8434342 GGCCGGTGTGACGCGTGCGCCGG + Intergenic
1176576391 21:8442406-8442428 GGACGGCGGAGCGAGCGCACGGG + Intergenic
1179882656 21:44300014-44300036 GGCGGGCGGAAGGCGCGCGCGGG + Intergenic
1180342426 22:11629053-11629075 GGTCGGCGTGCAGCGCGCGCAGG + Intergenic
1180599783 22:17008264-17008286 GGAGGGCGAGACCCGGGCGCAGG + Intergenic
1181725075 22:24806015-24806037 AGAGGGAGGGACGCGGGCGCTGG + Intergenic
1183683673 22:39349909-39349931 GGGCCGCCGGCCGCGCGCGCAGG + Intronic
1185255214 22:49827786-49827808 GGGCGGCGGGCGGCGGGCGCGGG + Intergenic
1203252056 22_KI270733v1_random:123372-123394 GGCCGGTGTGACGCGTGCGCCGG + Intergenic
1203254441 22_KI270733v1_random:131464-131486 GGACGGCGGAGCGAGCGCACGGG + Intergenic
1203260110 22_KI270733v1_random:168455-168477 GGCCGGTGTGACGCGTGCGCCGG + Intergenic
1203262497 22_KI270733v1_random:176543-176565 GGACGGCGGAGCGAGCGCACGGG + Intergenic
950094535 3:10321202-10321224 GGAGGGCGGGGCGCGCCCTCTGG - Intergenic
953410144 3:42686257-42686279 AGACGGTGGGCAGCGCGCGCTGG - Exonic
954121802 3:48504111-48504133 GGGCGGACGGACGCGAGCGCCGG + Exonic
954717463 3:52533740-52533762 GGGCGGCGGGCGGCGCGCGGTGG - Exonic
959849694 3:111071905-111071927 GGAGCTGGGGACGCGCGCGCCGG + Exonic
962164841 3:133038318-133038340 GGTCGGAGGGGCGCGCGCGGGGG + Intergenic
965881707 3:173395823-173395845 GACCGGCGGGAGGGGCGCGCAGG + Intergenic
966353823 3:179058467-179058489 GGACTTCGGGACGGGCGCGGTGG + Intronic
967867804 3:194204371-194204393 GCGCGGCGGGGCGTGCGCGCCGG - Intergenic
969113885 4:4859759-4859781 GAGGGGCGGGAGGCGCGCGCGGG + Exonic
969285592 4:6200213-6200235 GGGGGGCGGGAGGCGAGCGCTGG - Intronic
971405624 4:26319477-26319499 GGGCGGCGGGCGGCGGGCGCGGG - Intronic
973292395 4:48483506-48483528 GGACGGCGAGAGGCACGCGGCGG + Exonic
978754263 4:112285835-112285857 GGAAGGCAGGCCGCGCGCGCGGG - Exonic
981475284 4:145180808-145180830 GGTTGGCGGGTGGCGCGCGCAGG - Intergenic
983941615 4:173538829-173538851 GGAGAGGGGGACGCGCGCGGGGG + Intergenic
985565376 5:612640-612662 GGACGCCGGGACCCGAACGCGGG - Intronic
993905023 5:93612657-93612679 GGGGGGTGGGGCGCGCGCGCTGG + Intergenic
997955316 5:138274507-138274529 GGAGGGCGGGAGGCGGGGGCGGG - Exonic
998119049 5:139561364-139561386 GGACCGAGGGACGCGCGGGCGGG - Exonic
999272030 5:150302381-150302403 GCGCGCCGGGACGCGCGGGCCGG - Exonic
1000318815 5:160118417-160118439 GGACGGGGGGACGGGGGGGCGGG - Intronic
1002645286 5:180649680-180649702 GGACGGGGGGAGGGGGGCGCGGG - Intergenic
1003112128 6:3259222-3259244 GGGCGGCGGGGCGGGGGCGCGGG + Intronic
1004044620 6:12012231-12012253 GGAGCGCGGGGCGCGCGGGCGGG - Intronic
1004216889 6:13711625-13711647 AGGCGGCGGGCCGCGCGCCCAGG + Intergenic
1004720591 6:18264689-18264711 GGGCGGAGGGATGCGCGCGCGGG + Exonic
1007444510 6:41895010-41895032 GGGCGGCGGGAGGCGAGAGCCGG - Intronic
1007576675 6:42929583-42929605 AGACAGCGGGACGCGGGCTCAGG - Exonic
1010001701 6:70955889-70955911 GCACGCCGGGCTGCGCGCGCTGG + Exonic
1014079557 6:117270923-117270945 GGACTGCCGGGCGCGGGCGCCGG - Exonic
1015965543 6:138692927-138692949 GGACGGACGGACGGGCGCGCGGG + Intergenic
1017954968 6:159169756-159169778 GGACGACGGGGCCCGAGCGCAGG - Intronic
1018876533 6:167826886-167826908 GGGCGGCGGGCGGCGGGCGCCGG + Intergenic
1019235918 6:170612417-170612439 ACACGGCGTGACGCGCGCTCGGG - Intergenic
1019828195 7:3301148-3301170 GGGCGGCGGGCGGCGGGCGCGGG + Intergenic
1022230748 7:28410062-28410084 GGGCGGGTGGGCGCGCGCGCAGG + Intronic
1022410378 7:30135108-30135130 CGGCGGCGGGAGGCGGGCGCGGG + Exonic
1022427825 7:30285140-30285162 CGACGGCCTGACGCGGGCGCGGG - Exonic
1027232960 7:76282663-76282685 TGCTGGCGGGCCGCGCGCGCGGG - Exonic
1027539938 7:79453860-79453882 GGGAGGAGGGGCGCGCGCGCCGG + Intergenic
1028382159 7:90211818-90211840 GGAAGGAGGGAGGCGCGCGGAGG - Exonic
1032344360 7:131105946-131105968 GGGCGGCGGCGGGCGCGCGCGGG + Intergenic
1035515831 8:231950-231972 ACACGGCGTGACGCGCGCTCGGG - Intergenic
1038450030 8:27633934-27633956 CGGCGGCGGGATGCGCGCTCTGG + Intronic
1038761260 8:30385211-30385233 GGCCGGCGGGGCGCGGGCCCGGG + Intronic
1044320086 8:90791742-90791764 GCGCGGAGGGAGGCGCGCGCGGG + Exonic
1044819328 8:96145180-96145202 GGAGGCCGAGGCGCGCGCGCGGG - Exonic
1047381874 8:124372068-124372090 GGACGGCGGGCGGGGCGCGGCGG + Exonic
1048972870 8:139655019-139655041 GGATGGCGGGGGGCGGGCGCTGG + Intronic
1049470802 8:142774259-142774281 GGACTGGGGGATGCGCGCACAGG - Intronic
1053435169 9:38069309-38069331 GGGGGGCGGGGCGCGCGAGCGGG - Intergenic
1057230430 9:93318414-93318436 AGACGGCGGGACGCTGGGGCAGG + Exonic
1057922042 9:99105327-99105349 CGACTGCGGGGCGCGCGGGCCGG + Intronic
1057997111 9:99828593-99828615 GAAGAGCGGGAAGCGCGCGCCGG - Exonic
1058908240 9:109498325-109498347 GGCCGGCGGGAACCGCCCGCGGG - Intergenic
1061828327 9:133275264-133275286 GGGCGGCGGGCGGCGCGGGCCGG - Intergenic
1062022306 9:134325467-134325489 GGGCGGCGGGCGGCGCGCGGCGG + Intronic
1203468459 Un_GL000220v1:106522-106544 GGCCGGTGTGACGCGTGCGCCGG + Intergenic
1203470842 Un_GL000220v1:114608-114630 GGACGGCGGAGCGAGCGCACGGG + Intergenic
1203476280 Un_GL000220v1:150494-150516 GGCCGGTGTGACGCGTGCGCCGG + Intergenic
1203478663 Un_GL000220v1:158580-158602 GGACGGCGGAGCGAGCGCACGGG + Intergenic
1185747461 X:2584174-2584196 GGAGGGCGGGGGGCGCGCGGGGG + Intergenic
1189325811 X:40109873-40109895 GGAGCGCGGGAAGCGCGCGGGGG + Intronic
1190323422 X:49191661-49191683 GGGCGCCGGGAGGCGCGCGCAGG + Exonic
1190862632 X:54358645-54358667 GGACCGCAGTGCGCGCGCGCGGG + Intergenic
1195884386 X:109624521-109624543 GGAAGGTGGGAGGCGCGCCCAGG + Exonic
1200098172 X:153673830-153673852 GGCCGGCGGGGCGCGGGCGGGGG - Intronic