ID: 1106602902

View in Genome Browser
Species Human (GRCh38)
Location 13:31202322-31202344
Sequence CAGAATGAGAAGATTGAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 278}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106602902 Original CRISPR CAGAATGAGAAGATTGAGTC AGG Intronic
900010052 1:98332-98354 CAGAAGGAGAAAAGTGAGTGAGG - Intergenic
900026164 1:274916-274938 CAGAAGGAGAAAAGTGAGTGAGG - Intergenic
900035946 1:408769-408791 CAGAAGGAGAAAAGTGAGTGAGG - Intergenic
900057569 1:644520-644542 CAGAAGGAGAAAAGTGAGTGAGG - Intergenic
900115301 1:1025589-1025611 CAGGATGAGAACCTGGAGTCAGG - Intronic
905242188 1:36588480-36588502 CAGAATGAGAGAATTGGGACCGG - Intergenic
905264193 1:36739831-36739853 GAGAATGAAATCATTGAGTCAGG - Intergenic
905428868 1:37907034-37907056 CAGAATTAGAATATTGATCCAGG - Intronic
906555415 1:46707958-46707980 CAACTTGAGAAGATTGAATCTGG - Exonic
910487042 1:87726263-87726285 GAGAAGAAGAAGATTGATTCAGG + Intergenic
911888839 1:103341102-103341124 CACAATGAGAAGTTTGGGGCAGG - Intergenic
912156620 1:106929013-106929035 CAGAAAGAGGAGATGGATTCAGG + Intergenic
915913902 1:159930102-159930124 CAAGATGAGAAGATAGAGTTTGG + Intronic
916033068 1:160895264-160895286 AAGAATGAAAGAATTGAGTCAGG + Intergenic
920491810 1:206421733-206421755 AACAATGAGAAGATTAAGTCTGG + Intronic
921430421 1:215058858-215058880 CAGGATGACAAGAAGGAGTCTGG - Intronic
922258484 1:223914337-223914359 CAGAAGGAGAAAAGTGAGTGAGG - Intergenic
924659104 1:246000393-246000415 CAGAATGTGAAGATGGAGATAGG + Intronic
924693166 1:246371864-246371886 CAGAAGGAGAAGATGGCTTCAGG - Intronic
1063639718 10:7817904-7817926 TAGAATGACATGAGTGAGTCAGG + Intergenic
1063859533 10:10292540-10292562 GAAAATCAGAAGATAGAGTCGGG + Intergenic
1063893045 10:10649984-10650006 CAGAATGAGCAGATTACGGCGGG - Intergenic
1064141553 10:12795045-12795067 AAGAATGATAAGTTTGAGGCTGG + Intronic
1065682580 10:28252086-28252108 CAAAATGAAAAGATTGATTTTGG - Intronic
1067343528 10:45422277-45422299 CAGAATGAGAGGATGGAGGCTGG - Intronic
1069726862 10:70585741-70585763 CAGAAGGAGAAGAGTGACTTAGG + Intergenic
1071146027 10:82573296-82573318 CAGAATCTCAAAATTGAGTCAGG - Intronic
1071301969 10:84262505-84262527 CAAGGTGAGAAGACTGAGTCTGG + Intergenic
1074213320 10:111359203-111359225 AATAATGTGAAGATTGAGTGAGG - Intergenic
1074369009 10:112883787-112883809 CAGAATGAAAAGTTTAAGGCTGG - Intergenic
1075692993 10:124412645-124412667 AAGAGTGAGAATCTTGAGTCAGG + Intronic
1075960817 10:126566663-126566685 CAGAAAGAGAACAGTGAGACTGG + Intronic
1077680886 11:4238608-4238630 GAGAATGAGAAGATTGGATGTGG + Intergenic
1078135369 11:8647731-8647753 CAGGATGATCAGAGTGAGTCTGG - Intronic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1079314139 11:19393253-19393275 CAGCATGAGAAGAATGAAACTGG - Intronic
1079812532 11:25013205-25013227 CAGAATGTGAAGGGTGAGTTGGG + Intronic
1080347459 11:31340882-31340904 CAGAATGAGTAGATAGAGAAGGG + Intronic
1081583191 11:44366384-44366406 CAGAATGAGGAAATCCAGTCTGG + Intergenic
1081583198 11:44366442-44366464 CAGAATGAGGAAATCCAGTCTGG + Intergenic
1083369336 11:62165974-62165996 CAGATTGAGGAGAGTGACTCGGG + Intergenic
1083712410 11:64557326-64557348 CAGACTGCGAGGATTGACTCAGG - Intronic
1084045363 11:66564877-66564899 CAGAACGAGCAGAGTGAGTGAGG - Exonic
1086224767 11:84494516-84494538 CAGATGGAGAAGATAGAGTCAGG + Intronic
1087757237 11:102067262-102067284 TGAAGTGAGAAGATTGAGTCTGG + Intronic
1087850696 11:103024990-103025012 AAGAATGAGAAGAATGAGATGGG + Intergenic
1088006214 11:104944000-104944022 TAGAATGGGTACATTGAGTCTGG - Intronic
1089026760 11:115278897-115278919 GAAAATGCCAAGATTGAGTCTGG + Intronic
1089874632 11:121708150-121708172 CAGAGAGAGGAGATGGAGTCAGG - Intergenic
1090888624 11:130902162-130902184 CAGAATGAGAAAATAGAGCTTGG - Intronic
1091190911 11:133694678-133694700 AAGACTGAGAAGATTGAATGTGG - Intergenic
1091770144 12:3146118-3146140 TAAAATGAGAAGATTGGGCCAGG + Intronic
1093241799 12:16685985-16686007 GAGAAAGAGAAGATTGAGGAAGG - Intergenic
1095309343 12:40679348-40679370 CAGAGTCACAAGGTTGAGTCTGG - Intergenic
1095566741 12:43633402-43633424 CTGAATGAAAATATTGAGTGGGG - Intergenic
1095592538 12:43920018-43920040 CACAGGGAGAAGATTGAATCTGG - Intronic
1096710370 12:53451471-53451493 CAGAATGAAATAATTGATTCAGG - Intergenic
1097672434 12:62556042-62556064 GACAAAGAAAAGATTGAGTCTGG + Exonic
1098677487 12:73308887-73308909 CATTATGAAAGGATTGAGTCAGG + Intergenic
1100982527 12:100172861-100172883 CAGAAGGTGAAGACTGAGTATGG + Intergenic
1104233053 12:126904012-126904034 CAAAATGAAAAGATTGATTTTGG - Intergenic
1104851584 12:131877814-131877836 CAGAATGAGAACATGGAGATTGG - Intergenic
1104875329 12:132029779-132029801 CAGAATGAGGATCTTGAGGCAGG + Exonic
1106602902 13:31202322-31202344 CAGAATGAGAAGATTGAGTCAGG + Intronic
1107147612 13:37075479-37075501 CATATTGAGAAGTTTGAGTAGGG + Intergenic
1111117203 13:83795221-83795243 CAGAATGAGAAGATTCTGTTTGG + Intergenic
1111330297 13:86757400-86757422 CAGAATGTGGGGACTGAGTCAGG + Intergenic
1113227374 13:108174032-108174054 CATAAGCAGAAGATTGAATCTGG + Intergenic
1119126402 14:72131159-72131181 CAGAATAAGATGATTGAGTTAGG - Intronic
1119462453 14:74819250-74819272 CACAATGACAATATTGAGTATGG - Intronic
1119778905 14:77265390-77265412 CAGGATGGGAGGATGGAGTCAGG - Intergenic
1121522543 14:94596151-94596173 CACAATGATAAGAGTGAGCCTGG + Intronic
1121971281 14:98358694-98358716 CAGGAAGGGAAGATTGAGTTGGG - Intergenic
1122820743 14:104343571-104343593 CAGAATGAGAGGATTCAGGAAGG - Intergenic
1123987077 15:25655425-25655447 GAGAGTGAGAAGAATAAGTCAGG - Intergenic
1125053622 15:35331630-35331652 CAGAGTGAGGAGAATGAGACAGG + Intronic
1127320600 15:57841408-57841430 GAGAAGGAGAAGACTGAGGCTGG + Intergenic
1128886154 15:71289950-71289972 CAGAATGAGATGATGGTGCCCGG + Intronic
1129015626 15:72465928-72465950 AAGAATGCTAAGATTAAGTCAGG + Intergenic
1129102131 15:73275217-73275239 CAGAATCACAACATTGAGTAAGG - Intronic
1129377533 15:75143553-75143575 CAGAATGAGCAGATCCAGCCAGG + Intergenic
1131401451 15:92128631-92128653 CAGGATGAGAGGACTGATTCAGG + Intronic
1133375656 16:5284651-5284673 GAGAATCAGAAGACTGAGGCAGG - Intergenic
1134857995 16:17536784-17536806 CTGAATGAGAAGAGGGAGCCAGG + Intergenic
1135967677 16:27049391-27049413 CAGGCTGAGAAGCTGGAGTCAGG - Intergenic
1136220640 16:28825533-28825555 CAGAATGAGTAGAGTGCGGCGGG + Intronic
1136477303 16:30521513-30521535 CTGAAGGAGAAGATGGAGGCTGG + Exonic
1137517233 16:49157086-49157108 CAGAATGAAAATATTGGTTCAGG - Intergenic
1137750982 16:50860941-50860963 CCTAATGAGAAGCTTGAGTGAGG - Intergenic
1137892174 16:52174327-52174349 AAGAATGGGAAGATGGAGTGGGG + Intergenic
1138108817 16:54307087-54307109 GAGAAATAGAAGATTGTGTCAGG + Intergenic
1139326914 16:66159921-66159943 CACCATGAGAAGACTGAGCCTGG - Intergenic
1140941657 16:79726744-79726766 CAGAAGGGGAACAGTGAGTCTGG + Intergenic
1141147946 16:81544965-81544987 GAAAATGAAAAGATTGAGTCTGG - Intronic
1141780791 16:86159318-86159340 CAGAATGAGAATGTTGAGGATGG + Intergenic
1142454278 16:90208572-90208594 CAGAAGGAGAAAAGTGAGTGAGG + Intergenic
1143967991 17:10770647-10770669 CAGAATGGAAAGATGGATTCGGG - Intergenic
1143971854 17:10801603-10801625 CTGACTCAGAAGATGGAGTCAGG - Intergenic
1146593244 17:34146887-34146909 CAGAATGATGAGCTTCAGTCAGG + Intronic
1147258534 17:39196043-39196065 CAGAATGGGGAGAGTGAGTGAGG + Intronic
1148643345 17:49204588-49204610 CAGAATGGTGAGATGGAGTCAGG + Intronic
1149116844 17:53107806-53107828 TAAAATGAGAAGACTGAGTTAGG + Intergenic
1149546680 17:57509047-57509069 CAGACTGGGAAGATGGAGGCAGG - Intronic
1151043684 17:70894488-70894510 CTCAATGAAAACATTGAGTCTGG + Intergenic
1152985254 18:315176-315198 GAGAATGAAGAGAATGAGTCTGG + Intergenic
1155789262 18:29944850-29944872 CAGAATCAGAAGATTGATGAAGG - Intergenic
1157484694 18:48078520-48078542 CAGCATAAGAAGAGTGAGTTGGG + Intronic
1158046945 18:53167923-53167945 CAGAGTCAGAAGTGTGAGTCAGG + Intronic
1160813597 19:1025342-1025364 CAGAATGAGAGGCTTGGGGCTGG - Intergenic
1162268773 19:9597184-9597206 CTGAATGAGCAGAATGAGTCAGG + Intergenic
1162484776 19:10952886-10952908 CAGTCTGAGAAGAGTGAGTCTGG - Intergenic
1165163647 19:33834281-33834303 CAGAATGAGAAAAGAGAGTGTGG + Intergenic
1166400337 19:42474358-42474380 CAGAATGACAAGCATGGGTCAGG + Intergenic
1167129241 19:47573382-47573404 GAGAGTGAGAAGAGTGAGCCGGG + Intergenic
1167841050 19:52120500-52120522 CACAATCAGAAGATAGAGACTGG + Intronic
926558778 2:14392334-14392356 CTGAATGAGTAGACTGAGTGCGG - Intergenic
927482433 2:23464902-23464924 CAGAATGAGAGCATTGATTATGG - Intronic
928627296 2:33153406-33153428 CAGGATGAAAGGATGGAGTCAGG + Intronic
929158073 2:38805705-38805727 CAGAAAGAGAAGAGTGAATTGGG + Intronic
930523701 2:52499031-52499053 CAGAGTGAGAACATTGATTACGG + Intergenic
932455155 2:71844777-71844799 CAGAATGATAGGAATGAGTGAGG + Intergenic
934018383 2:87916025-87916047 TAGAATGAAAAGATTTAGTAGGG - Intergenic
935308780 2:101762252-101762274 CAGTAAGAGAATATGGAGTCTGG + Intronic
935471880 2:103470459-103470481 CAGAATTAGAATATTGATTCAGG + Intergenic
936457763 2:112688524-112688546 CAGAATGAGAAGATGGGTTCTGG - Intergenic
939000305 2:136727212-136727234 CAGATTGAGATGATTGAGTCTGG - Intergenic
939843576 2:147217512-147217534 CAGAATTAGAATATTGACCCAGG + Intergenic
941192041 2:162396985-162397007 TAGAAGGAGAACATTGAGTTTGG - Intronic
941724281 2:168844535-168844557 CATTATGAGAACATTGAGGCTGG + Intronic
942533688 2:176940212-176940234 CAGAATTAGAAGCCAGAGTCAGG - Intergenic
944992389 2:205253238-205253260 AAGAGTGAGAAGATAGAGACAGG + Intronic
946031472 2:216708423-216708445 CAGGATGAGAAGGCTGACTCAGG + Intergenic
948090392 2:235288734-235288756 CAGAATTAGGAGATTGGGGCCGG - Intergenic
949085736 2:242153227-242153249 CAGAAGGAGAAAAGTGAGTGAGG + Intergenic
1168864739 20:1075880-1075902 CACCATGAGAAGAATGTGTCTGG - Intergenic
1169748049 20:8963325-8963347 CTGAATGAGAAGAGTCAGCCAGG + Intronic
1170112771 20:12823269-12823291 AAAAATGAGAAGATTGTGCCAGG + Intergenic
1170313276 20:15015997-15016019 AAAAATGAGAAGGCTGAGTCAGG - Intronic
1170823450 20:19773413-19773435 CACAATCAGAAAATAGAGTCAGG + Intergenic
1171999825 20:31765223-31765245 CAAAATGAGAGGATTGATTGAGG + Intronic
1172336223 20:34118248-34118270 CAGAAGGAGAAGAATAAGCCAGG + Intergenic
1173752029 20:45484803-45484825 CAGAATGGGCTGATTGACTCTGG - Intergenic
1175180381 20:57142549-57142571 CCCAATGGGAAGACTGAGTCTGG + Intergenic
1175376659 20:58531477-58531499 CAGAATGAGAAGACAGAATGAGG - Intergenic
1178806162 21:35841383-35841405 CAGAGTGAGAAGACAGAGTGTGG + Intronic
1179341114 21:40510525-40510547 CTAAATGTGAAGATTGACTCAGG + Intronic
1183217482 22:36490279-36490301 CAAAATGAGGAGAATGAGCCAGG + Intronic
1185295480 22:50051214-50051236 AAGAATGATAAGATAGAGTTTGG - Intronic
949781380 3:7692522-7692544 AAGACTGAGATGAATGAGTCTGG - Intronic
949836111 3:8271896-8271918 AAGGAAGAGAAGATTGACTCAGG - Intergenic
950173156 3:10853125-10853147 CAGGCTGGGATGATTGAGTCGGG + Intronic
950473394 3:13200410-13200432 CAGAAAGAGAAACATGAGTCTGG - Intergenic
950499771 3:13356185-13356207 CAGAATGACAAGGTAGAGCCAGG - Intronic
950807053 3:15614409-15614431 CAGAAGGAGAAAATAGAGGCTGG - Intronic
951016772 3:17740962-17740984 CAGAGTGAGCAGGCTGAGTCTGG - Intronic
951260200 3:20498437-20498459 AAGAATGATATAATTGAGTCTGG - Intergenic
951349425 3:21587442-21587464 CCAAATGAGAAGAATGAGCCTGG - Intronic
952807281 3:37368444-37368466 CATAAGGAAAAGATTCAGTCTGG - Intergenic
953099464 3:39810332-39810354 CAGAATTAAGAGTTTGAGTCAGG - Intronic
953127491 3:40105763-40105785 CAGAGAGAGAAGAGTGAGGCAGG + Intronic
953286294 3:41613073-41613095 CATAATGAGAAGATTGTGTGGGG - Intronic
954297027 3:49679958-49679980 CAGAGCGAGAAGGATGAGTCTGG - Intronic
956225253 3:66950301-66950323 CATATGGAGAAGATTGAGTAAGG + Intergenic
956378386 3:68640149-68640171 CAGAATGTTAAGAGTGATTCTGG - Intergenic
957000311 3:74876704-74876726 CAGAATCAGAACATGGAGACTGG - Intergenic
957314565 3:78560759-78560781 CAGAAGGCAAAGATAGAGTCAGG + Intergenic
959046047 3:101474905-101474927 CACAATTAGAAGATTTAGACTGG + Intronic
959814313 3:110657796-110657818 CAGAAAAAGAAGATTGATGCTGG + Intergenic
960243336 3:115371733-115371755 CAGAATGATACGACTAAGTCAGG + Intergenic
961443415 3:126966384-126966406 CAGACTGAGCAGACTGAGACAGG + Intergenic
962224262 3:133592008-133592030 CAGAATGAGAAAATCTAGGCCGG - Intergenic
964739936 3:159954525-159954547 CTGAATCAGCAGATTGAGTGAGG - Intergenic
965100266 3:164289146-164289168 AAGAATGAGAAGATAGAGTTTGG + Intergenic
965398103 3:168185222-168185244 CAGAAGGAGAAGATTCAGAGGGG - Intergenic
965759430 3:172060010-172060032 AAGAATGTGAAGATTTAGCCAGG + Intronic
966365306 3:179179342-179179364 CAGAATGAGAAGAGTGCAACAGG - Intronic
966365359 3:179180257-179180279 CAGAATGAGAAGAGTGCAACAGG - Intronic
968788226 4:2640426-2640448 CAGAGTGAGAAGATTTAGGCTGG + Intronic
971243796 4:24911596-24911618 CAGTTTGAGAAGATGGAGCCAGG + Intronic
971311995 4:25533095-25533117 CAGAATGACAAGAATGGGCCGGG - Intergenic
971766186 4:30835190-30835212 CAGAGTCAGCAGATTGAGACAGG + Intronic
973213409 4:47641433-47641455 TAGAATGAAAAGATTCACTCTGG - Intronic
974153266 4:58037983-58038005 CAAAATGAGAAGAATGGATCTGG - Intergenic
975974700 4:80081538-80081560 GAGCATGAGAAGAGTGAGTAGGG + Intronic
976022158 4:80642141-80642163 CTGAACTAGAAGATTGAGTGTGG - Intronic
977895657 4:102361839-102361861 CAGAATGAGGAGAGTGTGTTAGG - Intronic
978652575 4:111024661-111024683 GAGAATGAGAAGTTTGTGTTGGG - Intergenic
978958290 4:114641815-114641837 GAAAATGAGAAGATTAATTCAGG - Intronic
979237437 4:118418128-118418150 CAGAAGGAGAAAAGTGAGTGAGG + Intergenic
979939059 4:126737124-126737146 CAGGATAAGAAGATTGAGAGAGG + Intergenic
980522113 4:133948563-133948585 GAGAATGAGAAGATTGCTTTAGG + Intergenic
980574928 4:134673725-134673747 CTGAGTGAAAAGATTGTGTCAGG + Intergenic
980680125 4:136150058-136150080 CAGAAAGAGAACACTGAATCTGG + Intergenic
980876811 4:138670082-138670104 CTGAAGCAGAAGATTGAGGCAGG + Intergenic
981728115 4:147869046-147869068 CAGAATGAGAACCTTCAGGCAGG + Intronic
981891742 4:149746384-149746406 CAGAATGAAATGATTGTGGCTGG - Intergenic
982456165 4:155611615-155611637 CAGAAGGAGCAGATTTAGTGAGG - Intergenic
982665644 4:158258640-158258662 CAAAATCAGAACTTTGAGTCAGG + Intergenic
983877088 4:172889966-172889988 CAGACTCCCAAGATTGAGTCAGG - Intronic
984115782 4:175679568-175679590 CATGATAAGAAGATTGGGTCTGG - Intronic
984640016 4:182153528-182153550 CAGAATGAGAAAATGGACTTCGG - Intronic
984788129 4:183588004-183588026 CAGACTGAGAATATTGCCTCAGG - Intergenic
985554285 5:548779-548801 CAGAATGTGAAGATGGATTAAGG - Intergenic
985713345 5:1442423-1442445 CAGAAAGCGAAGATCGAGGCAGG - Intronic
986596646 5:9429714-9429736 CAGAATGAAAAGACTGAGCAAGG + Intronic
986680591 5:10229630-10229652 CAGAATTAGCAGATTGATTCAGG - Intronic
988163608 5:27552737-27552759 CAGAAGGAGCATATTGAGTAAGG + Intergenic
989191703 5:38676702-38676724 CAGGATGACAGGATGGAGTCTGG + Intergenic
991521365 5:67501309-67501331 CAGAAAGAGAAAATTGTTTCAGG + Intergenic
994497575 5:100533609-100533631 CAGAATGAGAAATTTGTATCAGG + Intergenic
994844957 5:104976882-104976904 AAGAAAGAGAAGATAGAATCTGG + Intergenic
995466786 5:112458163-112458185 CAGAAAGAGAAGAAAGAGACAGG + Intergenic
997783052 5:136679134-136679156 CAGAATCAGATGATTGAATTAGG - Intergenic
997974196 5:138429682-138429704 CAGAATCAGAAAATTGATACTGG - Intronic
998976932 5:147658882-147658904 CAGCCTGAGATGATTGAGTTTGG - Intronic
1001777301 5:174338258-174338280 CAGAATGAGAAAATTGGAGCTGG + Intergenic
1002737875 5:181410095-181410117 CAGAAGGAGAAAAGTGAGTGAGG + Intergenic
1002931620 6:1638855-1638877 CTGCATGAGTAGAGTGAGTCTGG + Intronic
1003164857 6:3667957-3667979 CAATATGAGCAGATTAAGTCTGG + Intergenic
1003958444 6:11187844-11187866 CAGAAAGTGAAGATAGAGCCAGG - Intronic
1006833658 6:36984384-36984406 AGGAATGAGGAGATTCAGTCAGG - Intronic
1007963449 6:45982228-45982250 CAAACTGATAAGATGGAGTCAGG - Intronic
1009969225 6:70609028-70609050 AAGAATGAAAGAATTGAGTCAGG - Intergenic
1010953314 6:82062218-82062240 CATATTGAGAAAATTGAGTAAGG - Intergenic
1011232001 6:85172539-85172561 TAGAATCAGAAGATTTAGTTAGG + Intergenic
1013026216 6:106275302-106275324 CAGAATGAGAATATTCATTTCGG - Intronic
1013191823 6:107810199-107810221 CAGAGTGAGAAGAGCGAGCCTGG - Intronic
1013228972 6:108144214-108144236 CAAAATGGGAGGATTGAGTGAGG + Intronic
1013543513 6:111134181-111134203 CAGAATCAGAAGATGGAGATTGG + Intronic
1013929479 6:115514024-115514046 GAAATTGAGAAGATTGAGACTGG - Intergenic
1014919793 6:127200461-127200483 CAGAAAGAGAACAGTAAGTCTGG + Intergenic
1015172605 6:130270479-130270501 CAGAAAGAGAAGATTGCTTCAGG - Intronic
1016694905 6:146981703-146981725 CAGATTAAGAAGTTTGACTCTGG + Intergenic
1017280694 6:152621123-152621145 CAGAAGGAGATGAAAGAGTCAGG + Intronic
1017649428 6:156567477-156567499 AAGAATGAGAAAATGGGGTCAGG + Intergenic
1019242974 6:170685653-170685675 CAGAAGGAGAAAAGTGAGTGAGG + Intergenic
1021179359 7:17487990-17488012 AAGAAAGAGAAGATGGAATCTGG + Intergenic
1022395286 7:29982804-29982826 TTGATTGAGAAGATAGAGTCAGG - Intronic
1023409323 7:39873299-39873321 AGGAAGGAGAAGATTAAGTCTGG + Intergenic
1023506715 7:40907155-40907177 GAGAGAGAGAAGATTGAGTGGGG + Intergenic
1024686637 7:51752859-51752881 CAGAAGGAGAAGACTTGGTCAGG + Intergenic
1025043612 7:55670729-55670751 AGGAAGGAGAAGATTAAGTCTGG - Intergenic
1025136533 7:56419235-56419257 AGGAAGGAGAAGATTAAGTCTGG - Intergenic
1026050288 7:66940951-66940973 AATATTTAGAAGATTGAGTCTGG + Intronic
1027483112 7:78724158-78724180 AAGAATGAAAAGGTTGAGTCAGG + Intronic
1029123904 7:98284752-98284774 TAGAAAGGGAAGATGGAGTCAGG - Intronic
1030504070 7:110397796-110397818 CAAAATCATGAGATTGAGTCAGG + Intergenic
1031324850 7:120382211-120382233 GACAATGAGAAGATTAAGTGGGG - Intronic
1032050888 7:128650136-128650158 CGGAATGCGAAGTTTGAGCCTGG - Intergenic
1032282177 7:130512919-130512941 GAGAAAGAGAAGATGGAGGCTGG + Intronic
1033041252 7:137920314-137920336 CAGCATGAGAAGAATGAGCTAGG + Intronic
1033834481 7:145292531-145292553 GAGAATGAGAAGGGTGAGTTGGG - Intergenic
1033934510 7:146567171-146567193 TAGAATGATAAGAATGTGTCAGG + Intronic
1034134469 7:148753339-148753361 GAGAATGAGAAGATGGGGCCAGG - Intronic
1035505147 8:122509-122531 CAGAAGGAGAAAAGTGAGTGAGG - Intergenic
1035910494 8:3560464-3560486 CAGCATGAGAAGAATCAGTCTGG - Intronic
1037186091 8:16065239-16065261 TAGAAAGAGAAGAGAGAGTCTGG + Intergenic
1038205555 8:25461292-25461314 CACAAACAGAAGATTGATTCTGG + Intronic
1038787127 8:30628546-30628568 CAGAGTAAGAAGATTGAGAAAGG + Intronic
1039782237 8:40797016-40797038 CAGAGTGAGGGGAGTGAGTCTGG - Intronic
1041119041 8:54568027-54568049 CAGAATGGAAAAATAGAGTCTGG - Intergenic
1042449469 8:68927705-68927727 CAAAAGGAGAAGATTAAATCAGG - Intergenic
1042788724 8:72579813-72579835 CAGAATAAGAAGATAGAGTAAGG - Intronic
1043355650 8:79409291-79409313 CTCAATGTGAAGAATGAGTCAGG + Intergenic
1045206259 8:100044215-100044237 CAGAATGAGCAGAATGAGTTGGG - Intronic
1045213137 8:100119884-100119906 AAGAATGAGAAAATTTAGCCTGG - Intronic
1046006581 8:108493447-108493469 CTGAATGAGAAACTTGAGTGGGG + Intergenic
1046034928 8:108829406-108829428 CAGAATTAGACGATTAAGTATGG - Intergenic
1046223909 8:111251463-111251485 CAGAATGCCAACATTTAGTCTGG + Intergenic
1046725280 8:117667252-117667274 CAAAATGAGAAAAATGAGTTGGG - Intergenic
1047172277 8:122505428-122505450 CAGAGTGGGAAGACTGATTCTGG - Intergenic
1047412516 8:124635878-124635900 CTAAATGAGAATATTGAGGCAGG - Intronic
1047993080 8:130306964-130306986 CAGAATGAGAAGAGTTGGCCAGG - Intronic
1050247927 9:3711131-3711153 GAGAATGACAAGATTAAGTCAGG + Intergenic
1050807403 9:9698456-9698478 CAGTATGAGAAGACTGGGTAGGG + Intronic
1051370865 9:16357992-16358014 CACACTGAGAAGATTGTCTCTGG - Intergenic
1051892213 9:21954087-21954109 CAGTTTGAGAAGAATGGGTCAGG - Intronic
1052188171 9:25624135-25624157 CAGCATGTGAAGATTGAACCTGG - Intergenic
1056662406 9:88554127-88554149 CAGAGGGAGAAGATAGAGTGGGG + Intronic
1057557914 9:96102325-96102347 CAGAAGGAGAAGAAGGAGGCCGG + Intergenic
1059600744 9:115775554-115775576 CAGAAACTGAAGATTGAGTGTGG - Intergenic
1059790530 9:117637244-117637266 CAGAATGAGAGGATGGGGTTTGG - Intergenic
1059845598 9:118272450-118272472 CAGAAAGAGAACATGAAGTCAGG - Intergenic
1060045589 9:120337545-120337567 CATAATGAGCAGAACGAGTCTGG - Intergenic
1060137194 9:121168932-121168954 CATAATGAAATGATTGGGTCTGG - Intronic
1061278647 9:129584370-129584392 CAGAATGTGAGCATGGAGTCTGG + Intergenic
1062678518 9:137763124-137763146 CAAAGTGAGTAGATTGAGGCAGG + Intronic
1203603163 Un_KI270748v1:34877-34899 CAGAAGGAGAAAAGTGAGTGAGG + Intergenic
1187702082 X:21972527-21972549 AAGAATGAAAGAATTGAGTCAGG + Exonic
1188468705 X:30512443-30512465 CAGAAAGAGAAGAAAGAGTGGGG + Intergenic
1190127374 X:47718787-47718809 AAGAATGAAAGAATTGAGTCAGG - Intergenic
1190914369 X:54799396-54799418 CAGAATGAGAAGACTTTGTTGGG - Intergenic
1191703385 X:64066725-64066747 CAAAATCAGAAGATTGAAACTGG - Intergenic
1191942664 X:66497979-66498001 CTGAAGGAGATGATTAAGTCTGG + Intergenic
1193330862 X:80233911-80233933 CAGAATTAGAACATTGATTCAGG + Intergenic
1197234322 X:124042279-124042301 CAGCATGAGTAAAGTGAGTCAGG + Intronic
1197592792 X:128429084-128429106 ACAAATGAGAAGATGGAGTCTGG + Intergenic
1198670500 X:139075219-139075241 CAGAATGGGAAGATAGAGTCTGG - Intronic
1198863326 X:141094136-141094158 TAGGATGAGAAAATTGAATCAGG - Intergenic
1198899364 X:141493251-141493273 TAGGATGAGAAAATTGAATCAGG + Intergenic
1199126150 X:144123113-144123135 TAGAATGAAAAGATTTAGTAGGG + Intergenic
1200019780 X:153192850-153192872 GAGATTAAGAAGAGTGAGTCAGG - Intergenic
1202131430 Y:21615126-21615148 TAGGATGAGAAAATTGAGTCAGG + Intergenic