ID: 1106603944

View in Genome Browser
Species Human (GRCh38)
Location 13:31210224-31210246
Sequence GAATTCTGGTAAACTGCAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 114}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106603944_1106603948 -3 Left 1106603944 13:31210224-31210246 CCTGTTGCAGTTTACCAGAATTC 0: 1
1: 0
2: 0
3: 10
4: 114
Right 1106603948 13:31210244-31210266 TTCATGTTGAAAATGGAAAAGGG 0: 1
1: 0
2: 7
3: 99
4: 760
1106603944_1106603947 -4 Left 1106603944 13:31210224-31210246 CCTGTTGCAGTTTACCAGAATTC 0: 1
1: 0
2: 0
3: 10
4: 114
Right 1106603947 13:31210243-31210265 ATTCATGTTGAAAATGGAAAAGG 0: 1
1: 0
2: 1
3: 59
4: 624
1106603944_1106603949 -2 Left 1106603944 13:31210224-31210246 CCTGTTGCAGTTTACCAGAATTC 0: 1
1: 0
2: 0
3: 10
4: 114
Right 1106603949 13:31210245-31210267 TCATGTTGAAAATGGAAAAGGGG 0: 1
1: 0
2: 5
3: 59
4: 522
1106603944_1106603950 23 Left 1106603944 13:31210224-31210246 CCTGTTGCAGTTTACCAGAATTC 0: 1
1: 0
2: 0
3: 10
4: 114
Right 1106603950 13:31210270-31210292 ATTACTTTTAAACAGCAGTTTGG 0: 1
1: 0
2: 0
3: 39
4: 485
1106603944_1106603945 -10 Left 1106603944 13:31210224-31210246 CCTGTTGCAGTTTACCAGAATTC 0: 1
1: 0
2: 0
3: 10
4: 114
Right 1106603945 13:31210237-31210259 ACCAGAATTCATGTTGAAAATGG 0: 1
1: 0
2: 4
3: 26
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106603944 Original CRISPR GAATTCTGGTAAACTGCAAC AGG (reversed) Intronic
903560487 1:24223600-24223622 TAAATCTGGTAAACTGCTATTGG + Intergenic
907557949 1:55361178-55361200 GAATTCTCATACACTGCTACAGG + Intergenic
908061118 1:60350610-60350632 AAATACTGGAAAATTGCAACTGG - Intergenic
910748091 1:90595723-90595745 GAATTCTGGAGAGCTGCAAAGGG + Intergenic
911176374 1:94821583-94821605 GATTGCTGGTAAACTCCATCAGG + Intronic
916005605 1:160656954-160656976 GGATTCTGTGAAACTGCATCAGG - Intergenic
918408475 1:184234568-184234590 GAATTTTGGTGAACAGCAAATGG + Intergenic
920757086 1:208743093-208743115 GAATTCTGGAAAACTGTATCTGG - Intergenic
922279188 1:224106656-224106678 GATTTCTGGTAAATTCCAAAGGG - Intergenic
922930546 1:229385854-229385876 GAATTATTGTAAACTGTAGCTGG + Intergenic
1065280612 10:24134040-24134062 GAATTCTGGGAAAGTGCTCCAGG + Intronic
1065327623 10:24563129-24563151 AAATTCTGGTACACTCAAACTGG - Intergenic
1068407092 10:56604495-56604517 TAATGCTGCTAAATTGCAACAGG + Intergenic
1068413271 10:56684705-56684727 GACCTCTGATAAACTCCAACAGG + Intergenic
1068942663 10:62694857-62694879 GACTTCTTGTAGACTGAAACGGG - Intergenic
1072889482 10:99309764-99309786 GAACTCTGATACACTGCTACTGG + Intergenic
1077389913 11:2296022-2296044 GAATCCTGGTAAACTTAACCAGG - Intronic
1080133233 11:28820854-28820876 GAATCCAGTTAAACTGGAACTGG + Intergenic
1081005594 11:37733428-37733450 AAATTCTGGTAAATTGAATCTGG - Intergenic
1089866359 11:121636087-121636109 GAATTTTGATAAAATGTAACTGG - Intergenic
1092285020 12:7123717-7123739 GACTTCTGGAAAACTGTGACTGG - Exonic
1093976233 12:25425549-25425571 GAAACCTGGTAAACAGTAACAGG + Intronic
1101530768 12:105571286-105571308 GAAGTCAGGAAAGCTGCAACTGG + Intergenic
1103434042 12:120910835-120910857 GAATTCTTCTAAAGTGCACCTGG - Intergenic
1104153598 12:126108917-126108939 GAATTGTGGGGAAATGCAACAGG + Intergenic
1104557680 12:129816337-129816359 AAATTCTGGTGAAGTGGAACCGG + Intronic
1105291777 13:19058070-19058092 GAGTGCTTGCAAACTGCAACAGG - Intergenic
1106603944 13:31210224-31210246 GAATTCTGGTAAACTGCAACAGG - Intronic
1107981649 13:45739776-45739798 TATTTCTGGAGAACTGCAACAGG - Intergenic
1108742974 13:53357798-53357820 GAATTCTGGGCAACTGCAAGTGG + Intergenic
1109446145 13:62443409-62443431 GAGTGCTGGGAAGCTGCAACAGG - Intergenic
1111832976 13:93353322-93353344 GAATTCTGAAACACTCCAACAGG + Intronic
1113993050 14:16043232-16043254 GAAGTCTAGTAAACATCAACCGG - Intergenic
1114017766 14:18447023-18447045 GGATTCTAGGAAACTGCTACTGG - Intergenic
1116412256 14:44638457-44638479 GATTTCTGGTCAACTTCAACAGG + Intergenic
1116503818 14:45653120-45653142 GAATTCTGGAAAAATGCAGGTGG + Intergenic
1116978976 14:51147594-51147616 CAATTCTGGTACACTGAATCAGG - Intergenic
1123890875 15:24777028-24777050 GAATACTGGTAAACTTCATGGGG + Intergenic
1125040199 15:35177140-35177162 GCATTCTGGTAATCTGAAAATGG + Intergenic
1125270320 15:37932043-37932065 GAAGGCTGGAAAAGTGCAACAGG - Intronic
1125526328 15:40377683-40377705 GAATTCTGGGGATCTGCAAAGGG + Intergenic
1128913878 15:71542112-71542134 GAATTCTGGTTAAATGCAGAAGG + Intronic
1137239881 16:46647158-46647180 CAATTCTGGTCAAATTCAACAGG - Intergenic
1142586442 17:977606-977628 GAATTATGGTAAAATGTTACAGG - Intronic
1203156447 17_GL000205v2_random:8383-8405 GAATTCCAGAACACTGCAACGGG - Intergenic
1203158640 17_GL000205v2_random:28885-28907 GGATTCTGGTACACTGCTTCTGG - Intergenic
1159983032 18:74809324-74809346 AAATTCAGGTATACTGCAAATGG - Intronic
928509907 2:31993586-31993608 GAACTCTGGAAATCTGCAAAGGG + Intronic
928781259 2:34823934-34823956 TAATTCTGGTAAAGAGCAATGGG + Intergenic
930668570 2:54123904-54123926 GAAGTCTGGGAAACATCAACTGG + Intronic
937073226 2:119081593-119081615 GAATTCTTGTATACTGCTGCTGG - Intergenic
938538648 2:132267653-132267675 GAAGTCTAGTAAACATCAACGGG + Intergenic
940634945 2:156287704-156287726 AAATTCTGGTAAAGTACAACTGG + Intergenic
944339254 2:198576448-198576470 GATTTCTTTTAAAATGCAACAGG - Intergenic
1171566630 20:26198761-26198783 GACTTCTGGGAAATTGAAACTGG + Intergenic
1171811975 20:29752546-29752568 GAAGTCTAGTAAACCTCAACCGG + Intergenic
1171907705 20:30913131-30913153 GAAGTCTAGTAAACATCAACCGG - Intergenic
1172074377 20:32282847-32282869 GAATTCTGGTAGAGTACAATAGG - Intronic
1172730093 20:37079848-37079870 GAAGCCTGGCAAACTGAAACTGG - Intronic
1173074368 20:39802640-39802662 GAATTCCGGGAAGCTGGAACTGG - Intergenic
1175377376 20:58537814-58537836 GAATTCTCATACACTGCAGCTGG - Intergenic
1177205471 21:18005724-18005746 GGATTCTGGTTAACTACAAAAGG - Intronic
1178067963 21:28927354-28927376 GAATTCTCTTAAACTGCAGCTGG + Intergenic
1180314218 22:11264287-11264309 GAAGTCTAGTAAACATCAACCGG + Intergenic
1180341145 22:11619265-11619287 GAAGTCTAGTAAACATCAACCGG - Intergenic
1180442270 22:15377893-15377915 GGATTCTAGGAAACTGCTACTGG - Intergenic
951083380 3:18479540-18479562 AAAGACTGGTAAACTTCAACTGG - Intergenic
952225315 3:31369446-31369468 GACTTCTGGTAAACTCCAATAGG + Intergenic
954417847 3:50402751-50402773 GAATTCTGATAAATTCCACCTGG - Intronic
956429945 3:69176470-69176492 GAATTCTTTTGAACTGGAACAGG + Intronic
956551675 3:70467677-70467699 GTATTCTGGTAGCCTGCAATAGG - Intergenic
956940585 3:74156888-74156910 GAACTCTGGTATACTGCCAGTGG - Intergenic
957111514 3:75965795-75965817 GAGTTCTGGGAAATTGAAACTGG - Intronic
957460722 3:80515840-80515862 GAATTATGGTAAACTGTATTAGG + Intergenic
957554725 3:81751489-81751511 GCTTTCTTGTAAACTTCAACTGG - Intronic
958471062 3:94520704-94520726 GAATTGTGGCAAACTGCTAGTGG - Intergenic
958627823 3:96648660-96648682 GAATCCAGATAAACTGCAGCGGG + Intergenic
962630431 3:137270259-137270281 GAGTTCTGGTAAACTCCAGAGGG - Intergenic
962706236 3:138047400-138047422 GAATTCTTGGAACTTGCAACGGG + Intergenic
966755183 3:183363148-183363170 AAATTCTGGCAAAGAGCAACAGG + Intronic
967174358 3:186849391-186849413 GAATTCTCCTAAAATGCAAAAGG + Intronic
968001964 3:195212374-195212396 AAATTCTGGTCAGCTGCACCTGG + Intronic
969190639 4:5515920-5515942 GAATTCCTGTAAGCTGAAACTGG - Intergenic
970116725 4:12705439-12705461 GATTTCTTCTAAACTCCAACTGG - Intergenic
971876701 4:32318062-32318084 AAACTCTGGTAAAGTGCCACTGG - Intergenic
973924828 4:55727197-55727219 GAATCCTTGTACACTGCTACTGG - Intergenic
974841952 4:67308975-67308997 CAATTCTGTTAAAATGCAAAAGG - Intergenic
980322642 4:131298954-131298976 GATTTCTGATAATCTCCAACTGG + Intergenic
982803577 4:159735097-159735119 GAACTCTGGTAAATTGTCACAGG - Intergenic
983415407 4:167446341-167446363 GAGTTCTTGTAAACTGCTACAGG + Intergenic
986197146 5:5548098-5548120 GAATCCTGGTACACTGTCACTGG + Intergenic
988615253 5:32768961-32768983 GAACTCTGGGAAAATGCAAAGGG - Intronic
989991255 5:50769594-50769616 AAATATTGGTAAACAGCAACTGG - Intronic
991555093 5:67886894-67886916 GAATTCAGGCAAGCTGCAAAGGG + Intergenic
992996051 5:82334640-82334662 GAATTATGGTAAACTGCTTCTGG + Intronic
998592626 5:143494153-143494175 GAATATTGGCAAACTGGAACAGG - Intergenic
1000675064 5:164111621-164111643 GCATTCTGGGAAGCTGAAACAGG + Intergenic
1004010883 6:11686208-11686230 GAATATTGGAAAACTACAACTGG + Intergenic
1005513484 6:26532897-26532919 GAATGCAGGAAAACTACAACAGG + Intergenic
1015689053 6:135900311-135900333 GAATACTGGTAAACTTTAAGTGG + Intronic
1017040403 6:150303893-150303915 GAATTGTGGTAAAGTGGAACAGG - Intergenic
1022515378 7:30971893-30971915 GGATTCTGGTGTGCTGCAACTGG - Intronic
1024730759 7:52251457-52251479 CAATTCTGGTAAACCCCAACTGG + Intergenic
1025737856 7:64168872-64168894 ACATTCTGGTAAACTGGAAAAGG + Intronic
1029901823 7:104048976-104048998 GAATTCTGGTATTCAGCATCAGG + Intergenic
1034135570 7:148765294-148765316 GAAATCTGGAAAAATTCAACTGG - Intronic
1038868369 8:31464758-31464780 GCACCGTGGTAAACTGCAACAGG - Intergenic
1048818480 8:138356526-138356548 GAATTCTGGTTAACTCCATTGGG + Intronic
1049064664 8:140303532-140303554 TAACTCTGGTCAACAGCAACAGG + Intronic
1050019125 9:1265838-1265860 CAATGCTGGTCAACTGCAGCTGG + Intergenic
1050650470 9:7770448-7770470 CAATTCTGGGAAACTGCATGAGG + Intergenic
1051978988 9:22990319-22990341 GAACTGAGGTAAACTGCACCTGG - Intergenic
1052083689 9:24238152-24238174 GAATTGTGGAAAACTGCGGCTGG + Intergenic
1054788386 9:69231624-69231646 GAAATCTGAAATACTGCAACGGG - Intronic
1057268582 9:93634520-93634542 GAGTGCTTGCAAACTGCAACAGG + Intronic
1057455381 9:95204405-95204427 GAAATCTGCTAAACTTCCACTGG + Intronic
1060091983 9:120751173-120751195 GAAATATGTTGAACTGCAACAGG - Intergenic
1203362525 Un_KI270442v1:230409-230431 GAAGTCTAGTAAACATCAACCGG + Intergenic
1186305353 X:8250899-8250921 GAATTCTAGCATACAGCAACGGG + Intergenic
1186818457 X:13261648-13261670 GAATTCTGGTAGCCTGCAGAAGG - Intergenic
1193187286 X:78528360-78528382 GAATTATTGTAAACTGAACCAGG + Intergenic
1194667113 X:96687404-96687426 GAATTCTGGAAAAATGGAAATGG + Intronic
1196915428 X:120529600-120529622 TAGTTCTGGTAAACTGAAATTGG - Intronic
1197576565 X:128219314-128219336 GAATTCTGTGAAACTCCACCAGG - Intergenic
1197787343 X:130212058-130212080 GCAGACTGGTAAACTGCAAAAGG + Intronic