ID: 1106606449

View in Genome Browser
Species Human (GRCh38)
Location 13:31233750-31233772
Sequence TCTAATCTTTAGAAGGGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 434
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 401}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106606442_1106606449 4 Left 1106606442 13:31233723-31233745 CCTGGATTCAGCTAGAACTCAAG 0: 1
1: 0
2: 1
3: 11
4: 150
Right 1106606449 13:31233750-31233772 TCTAATCTTTAGAAGGGAAAGGG 0: 1
1: 0
2: 1
3: 31
4: 401
1106606441_1106606449 5 Left 1106606441 13:31233722-31233744 CCCTGGATTCAGCTAGAACTCAA 0: 1
1: 0
2: 2
3: 11
4: 138
Right 1106606449 13:31233750-31233772 TCTAATCTTTAGAAGGGAAAGGG 0: 1
1: 0
2: 1
3: 31
4: 401

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106606449 Original CRISPR TCTAATCTTTAGAAGGGAAA GGG Intronic
901105484 1:6752456-6752478 TCGAAACTTTAGCAGGGAAGGGG + Intergenic
901147179 1:7073141-7073163 TCTAATGTTTCCAAAGGAAAGGG + Intronic
902209930 1:14897427-14897449 TCTAATTTTTACAAGAGTAAAGG - Intronic
902243819 1:15106105-15106127 TTTAATTTTTAGTAGAGAAAAGG - Intronic
902580377 1:17404158-17404180 TCAAGGCTTTGGAAGGGAAATGG - Intergenic
902765163 1:18609496-18609518 TCTCATCTTTAAAAAGGAAATGG - Intergenic
903003603 1:20283847-20283869 TCTTATCTTTAGAGTGGAGATGG - Intergenic
904096311 1:27980864-27980886 TTTAATTTTTTGTAGGGAAAAGG - Intronic
904938161 1:34146440-34146462 TTTACTCTTTAGAATGGAAGAGG - Intronic
905032759 1:34898931-34898953 TCTCATCTTTAAAATGGCAATGG - Intronic
905900482 1:41578790-41578812 CCTAAGCTATAGAAGGGAGATGG + Intronic
906369949 1:45245045-45245067 GCTCATCTTTAGAAGGGAGAGGG - Intronic
906805388 1:48775660-48775682 TCTTCTCTTTACAAAGGAAAAGG + Intronic
907059166 1:51403667-51403689 TATAATCTTTTTTAGGGAAATGG + Intronic
907217877 1:52881542-52881564 TTTACTCTGTAGCAGGGAAATGG + Exonic
911110510 1:94179219-94179241 TCCAATCTGTGTAAGGGAAAGGG - Intronic
912083354 1:105967509-105967531 TCTCATCTTTAAAAAGAAAATGG + Intergenic
912109727 1:106326546-106326568 TCTAGTCTCAAGAAAGGAAAAGG + Intergenic
915798259 1:158760624-158760646 TCTAATCTTTAAAAGGCCCAGGG - Intergenic
915885610 1:159717972-159717994 ACTTATGTTTAAAAGGGAAAGGG + Intergenic
916796959 1:168176472-168176494 CCTAAACTTTAAAAGGGAGAAGG - Intergenic
916900971 1:169223112-169223134 TCTAATCTTTAGAAATATAAAGG - Intronic
917301556 1:173579957-173579979 TCCATTTTTTAGAAGGAAAAGGG + Intronic
918685116 1:187404911-187404933 TATAATCTTTATCAAGGAAAAGG - Intergenic
919220158 1:194617767-194617789 TCTCATCTTTAGCAGAGACAGGG - Intergenic
919342531 1:196331160-196331182 TCTAATCTTAAGCAGCAAAATGG + Exonic
919369883 1:196709711-196709733 TTTTATCTATAGAAAGGAAAAGG - Intronic
919597088 1:199577770-199577792 ACTAAGCTTTTGAAGGGATAGGG + Intergenic
920572028 1:207024645-207024667 TCAGAGCTCTAGAAGGGAAAGGG - Intronic
921086361 1:211797081-211797103 TGTAATTTTTAGAAGAGACAGGG - Intronic
921367741 1:214389777-214389799 TATACTCTAAAGAAGGGAAAAGG + Intronic
924158641 1:241207269-241207291 CTTGATCTTTAGAAGGGAAAGGG - Intronic
924898540 1:248369631-248369653 TCTAGGCTTTAGAAGGGCAGAGG + Intergenic
1063873416 10:10445088-10445110 TCTATTCTATCTAAGGGAAAGGG + Intergenic
1064061019 10:12137212-12137234 TCAATTCTTTTGCAGGGAAAGGG + Intronic
1064130106 10:12701933-12701955 TCTAGTCAGCAGAAGGGAAAAGG + Intronic
1064271464 10:13870053-13870075 CCTAATCCTTACAAAGGAAAGGG + Intronic
1065023961 10:21524493-21524515 TCTAAACTTTCAAAAGGAAAGGG - Intronic
1065169797 10:23015137-23015159 TCTAATATGGAGAAGAGAAAGGG + Intronic
1065564073 10:26991397-26991419 TTCAATATTTAAAAGGGAAAGGG + Intergenic
1065682474 10:28250980-28251002 TTTAATTTTTAAAAGGAAAATGG + Intronic
1066053848 10:31662207-31662229 TCTTATCTTTAGTAGAGACAGGG + Intergenic
1066082013 10:31940409-31940431 TCAAATCATTAGAATGGAAGAGG + Intergenic
1066244749 10:33571537-33571559 TCTTATTTTTAAAGGGGAAAGGG + Intergenic
1066496411 10:35946664-35946686 GATAGTCTTTGGAAGGGAAAAGG - Intergenic
1066670524 10:37833106-37833128 TCTCATTTCTAGAAAGGAAATGG - Exonic
1068273707 10:54763966-54763988 TCTAATTTTTAAAAGTAAAAAGG + Intronic
1069171868 10:65241015-65241037 TCAAATTTTTAGTAGGGACAGGG - Intergenic
1070471855 10:76788347-76788369 CCTAATCTTTAGGAGGAAATTGG - Intergenic
1071389113 10:85152650-85152672 GCCTATCTTTAGATGGGAAAAGG - Intergenic
1071812132 10:89194456-89194478 TTTAATCTTTGGAAGGTAAAGGG - Intergenic
1072168225 10:92834635-92834657 TCTAATAATTATAAGGAAAACGG + Intergenic
1072710040 10:97710301-97710323 TTTAATCTTTAGTAGAGACAGGG + Intergenic
1072855783 10:98944625-98944647 ACTAAGCTTTAGAGGGGAGAAGG + Intronic
1073576865 10:104633389-104633411 TCTTTTCTTTAGGAGGTAAATGG + Intergenic
1073686643 10:105761649-105761671 TCTAGATTTTAGAAGGAAAAGGG + Intergenic
1074899818 10:117806338-117806360 CCTTATCTTTAGAATGGATATGG + Intergenic
1079525584 11:21383850-21383872 TCTGATCTTGAGAAGCCAAAGGG - Intronic
1079676286 11:23231016-23231038 TCAAACCTTCAGAAGGCAAAGGG - Intergenic
1079944803 11:26728675-26728697 ACTCATCTTTAAAATGGAAATGG + Intergenic
1080274013 11:30483224-30483246 ACTTATCTTTTTAAGGGAAATGG + Intronic
1080302654 11:30801292-30801314 TCTCATCTGTAAAATGGAAATGG - Intergenic
1080630785 11:34073594-34073616 TCTAATTTTTAGTAGGGATGGGG + Intronic
1081134957 11:39429090-39429112 TGCAATCTATAGAAGGGAATTGG + Intergenic
1083438436 11:62659529-62659551 TTTAATCTTTAGTAGAGACAGGG - Intronic
1083674946 11:64319875-64319897 CCTGATCTTCAGAAGGGGAAGGG - Intronic
1085620348 11:78033162-78033184 GCTAATCCTAAGAATGGAAATGG - Intronic
1086207679 11:84279644-84279666 TCTCATCTTTTGCAGGGACATGG + Intronic
1087403650 11:97700940-97700962 TCTAATGTTTATCATGGAAATGG + Intergenic
1088318733 11:108533375-108533397 TCTAATTTTTAGTAGAGACAGGG + Intronic
1089712860 11:120329051-120329073 TGTTATCCTTAGAAGGGATAAGG - Intronic
1089780192 11:120868393-120868415 TTTAATATTTAGAAGAGACAGGG + Intronic
1089922787 11:122226731-122226753 TTTCATCTTCAGAAGGGAACAGG - Intergenic
1090687705 11:129141820-129141842 TTTTATTTTTACAAGGGAAAGGG + Intronic
1092710658 12:11333803-11333825 TCAAATCTTTAGCAGAAAAATGG - Intergenic
1092715379 12:11383877-11383899 TCAAATCTTTAGCAGAAAAATGG - Intronic
1093096117 12:14974064-14974086 TGTAATCTTCAAAAGGGGAAGGG + Intronic
1094798000 12:33999024-33999046 CCTAAGCTTTAGAAGAAAAATGG + Intergenic
1095110765 12:38293078-38293100 CCTAAGCTTTAGAAGAAAAATGG + Intergenic
1095366320 12:41410727-41410749 CCTCATCTTTAAAAGTGAAAGGG + Intronic
1095536538 12:43255119-43255141 TCTAAGCTTTAAAAGTGATAAGG - Intergenic
1096767552 12:53905479-53905501 TCTAGTGTTTAGGAGGAAAAGGG - Intergenic
1097494645 12:60315425-60315447 TTTAATGTTTAAAGGGGAAAAGG + Intergenic
1097724046 12:63053921-63053943 CCCACTCTTTAAAAGGGAAAGGG - Intergenic
1098351827 12:69570849-69570871 TCTTCTCTATAAAAGGGAAATGG + Intronic
1099089453 12:78286716-78286738 TCTAGTCTTTAAAATTGAAAAGG + Intergenic
1099112276 12:78576312-78576334 TGTATTCTAAAGAAGGGAAATGG - Intergenic
1100042492 12:90337430-90337452 TTTAAGCTTTCAAAGGGAAAAGG - Intergenic
1100459500 12:94785185-94785207 TCTAATCTGTAAAATGGAGATGG + Intergenic
1101043181 12:100777597-100777619 TCTAAGTTTTATATGGGAAAAGG + Intronic
1101889639 12:108701663-108701685 TCTTATCTGTAAAAGGGGAAGGG - Intronic
1102398783 12:112610808-112610830 TCTTATCTTTAGTAGAGACAGGG + Intronic
1103734343 12:123049603-123049625 TCTACACTGTAGAAGGGACAGGG - Intronic
1104143286 12:126008560-126008582 TTTAATTTTTAGAAGAGACAGGG + Intergenic
1104573947 12:129949535-129949557 TCTCATCCATAGAAGGGAAGCGG - Intergenic
1105700322 13:22930725-22930747 TCTACTCTTAAGTGGGGAAATGG - Intergenic
1106282516 13:28288462-28288484 GCTAATCTTTAGTAGCGACAAGG + Intronic
1106595410 13:31131275-31131297 TGTCATTGTTAGAAGGGAAAGGG + Intergenic
1106606449 13:31233750-31233772 TCTAATCTTTAGAAGGGAAAGGG + Intronic
1106847375 13:33750510-33750532 TCTAAGCATCAGAAGGCAAATGG + Intergenic
1107341583 13:39412748-39412770 TTTAATTTTTAGTAGGGACAGGG - Intronic
1107438904 13:40406531-40406553 TCTCAACTTTTGAAGGGAATGGG - Intergenic
1107836366 13:44415174-44415196 TCTAATTTTTAGTAGAGACACGG - Intergenic
1108173222 13:47765567-47765589 TCAAAACTTAAGCAGGGAAAGGG - Intergenic
1109147226 13:58794673-58794695 TCTGATCTATATAAGGGAAATGG - Intergenic
1109352098 13:61195840-61195862 TCTAATGTTTAGAAAGGAGAAGG + Intergenic
1109355554 13:61227873-61227895 TCTAATATTCAGAAGGGGAGAGG - Intergenic
1109552096 13:63917100-63917122 TCTAATTTTTAACAGAGAAATGG + Intergenic
1109624062 13:64951618-64951640 TCTAAGTTTTAGAAATGAAAAGG - Intergenic
1110211755 13:72981473-72981495 TCTATTCTTCAAAATGGAAAAGG - Intronic
1110967345 13:81716215-81716237 TCAAATATTTAGAAAGGAATAGG - Intergenic
1111236630 13:85417834-85417856 TCAAAACTTAAGCAGGGAAAGGG + Intergenic
1113923529 13:113928064-113928086 TCAAGTATTTAAAAGGGAAATGG + Intergenic
1116457391 14:45134918-45134940 TGTGATCTTTAAAAGGGAAATGG - Intronic
1116516872 14:45815192-45815214 CCTAATATCTAGAAGGGGAAAGG + Intergenic
1116517599 14:45819585-45819607 CCTAATATTTAGATGGGAAGAGG - Intergenic
1117122090 14:52579113-52579135 TCTAATCTTTCAAAGAGTAAAGG + Intronic
1117275595 14:54190155-54190177 TCTAATCATTGAGAGGGAAATGG + Intergenic
1117759195 14:59008847-59008869 TCTAATCTTGGCAAAGGAAAGGG + Intergenic
1118553686 14:66987856-66987878 TCTTATTTTTAAAAGGAAAAAGG + Intronic
1118555930 14:67021614-67021636 TCTAATGTATATAATGGAAATGG - Intronic
1118976377 14:70680724-70680746 TCCAATTTTTAAATGGGAAAAGG + Intergenic
1119526403 14:75326002-75326024 TGTATTTTTTAGTAGGGAAAGGG + Intergenic
1120599402 14:86482666-86482688 TCTCATCTGTAAAATGGAAATGG - Intergenic
1121231340 14:92361010-92361032 TTTAATCTTTAAAAAGGAGAGGG + Intronic
1122189001 14:100025114-100025136 TCTTATCTTAAAAAGGAAAATGG - Intronic
1122679931 14:103451806-103451828 TAAAATCTTTAACAGGGAAAAGG + Intronic
1122825931 14:104370464-104370486 GCTCATCTTTAGCAGAGAAATGG + Intergenic
1124111401 15:26792771-26792793 TCTAATTTTAAGAAAAGAAAAGG - Intronic
1124924292 15:34056123-34056145 TCTATTCTTAACTAGGGAAACGG - Intronic
1125195750 15:37044103-37044125 TCTTATCTGTAGAATGGAGATGG - Intronic
1125261904 15:37835852-37835874 TGTAATTTTTAGAAGAGAAAAGG + Intergenic
1125644955 15:41264615-41264637 TCTAATTTTTTGTAGGGACAGGG + Intronic
1126669723 15:51105010-51105032 TTTCATCTTCAGAGGGGAAAGGG - Exonic
1127181247 15:56420614-56420636 TCTAATTTTTAAAATGGAAGTGG + Intronic
1127845967 15:62871281-62871303 TGTAAACTTTATAAGGGGAAGGG + Intergenic
1128384208 15:67135429-67135451 TCTAATCTTAACAATGAAAAAGG - Intronic
1129562226 15:76583176-76583198 TTTAATTTTTAGTAGGGACAGGG - Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1131384235 15:91989936-91989958 GCTAATCTTTTCAAGGCAAATGG - Intronic
1131823774 15:96299692-96299714 TCTTATCTTTTGGGGGGAAAGGG + Intergenic
1133714342 16:8432583-8432605 TCTAAACTCCAGAAGGGAGAGGG + Intergenic
1134052979 16:11150186-11150208 TAGAATCTTTAGGAGGTAAAAGG - Intronic
1135106045 16:19650627-19650649 TCTAATGTTTTCAAGAGAAATGG + Intronic
1138139107 16:54551623-54551645 ACAAATCTATAGAAGGGAGAAGG - Intergenic
1138336192 16:56255009-56255031 TCTCATCTTAAGTAGGGACAGGG - Intronic
1138626588 16:58256966-58256988 TCTAAACTGTAGGAGGTAAATGG - Intronic
1138768122 16:59628624-59628646 TCTTGTCTTTGGAAGGGCAATGG + Intergenic
1139450481 16:67025004-67025026 TCTAGTTTTTAGAAGGCAATGGG - Intergenic
1140440497 16:74984350-74984372 TCTCACCTGTAGAAGGGAGATGG - Intronic
1140808109 16:78552199-78552221 TATCATCTTTTGAGGGGAAATGG - Intronic
1144382391 17:14715036-14715058 TCTGAATTCTAGAAGGGAAAGGG - Intergenic
1144552521 17:16253772-16253794 TTTAATTTTTAGTAGGGATAGGG - Intronic
1144962561 17:19053621-19053643 TTTAATCTTTAGTAGAGACAGGG - Intergenic
1144972600 17:19120900-19120922 TTTAATCTTTAGTAGAGACAGGG + Intergenic
1145823370 17:27857752-27857774 TATAATATTTAAAAGGAAAATGG - Intronic
1146093645 17:29907197-29907219 TCATATCTTTTGCAGGGAAATGG + Intronic
1146339757 17:32008245-32008267 CCTAAACTTTAGAGGGGAAATGG + Intronic
1148623807 17:49053993-49054015 TCGAGTATTTGGAAGGGAAATGG - Exonic
1149128029 17:53259076-53259098 TGTAATTTTTAGAAGAGACAGGG + Intergenic
1149270821 17:54975590-54975612 TTTAACCTTTAGAAGGTTAAAGG + Intronic
1150247350 17:63686538-63686560 CCTAAGCTTTGGAGGGGAAAGGG + Intronic
1151101968 17:71566229-71566251 TAAAATCTTTAGAAGTGAATAGG - Intergenic
1151103498 17:71584194-71584216 AGTAATCTTTCAAAGGGAAATGG + Intergenic
1151522867 17:74642948-74642970 TTCAATATTTAAAAGGGAAAGGG - Intergenic
1153021651 18:634838-634860 TTTAGTCTGGAGAAGGGAAAGGG - Intronic
1153181902 18:2444727-2444749 CCTATGCTTCAGAAGGGAAAGGG + Intergenic
1153318222 18:3745487-3745509 TATAATCTAAACAAGGGAAAAGG + Intronic
1154473047 18:14723345-14723367 TGTAATTTTTAGTAGAGAAAGGG + Intergenic
1155129462 18:22917276-22917298 TCTTAACTTTACAAGAGAAAAGG + Intronic
1156055332 18:32995623-32995645 TATATTCTTTAGAAGGAATATGG - Intronic
1157018825 18:43754062-43754084 TCTAATTTTTGGAAGAGACAAGG + Intergenic
1158271859 18:55725165-55725187 TATAATTTTTAGAATGAAAAAGG - Intergenic
1158585857 18:58734001-58734023 TCTACTCCTTAGAAAGGCAATGG - Intronic
1158767178 18:60466141-60466163 TCTAATCTATATAATTGAAAAGG - Intergenic
1162455038 19:10778477-10778499 TTTAATCTTTAGTAGAGACAGGG - Intronic
1165347172 19:35255853-35255875 TCTGAACTCTAGAAGGGCAAGGG + Intronic
1165566486 19:36733593-36733615 TTTAATTTTTAGTAGGGACAAGG - Intronic
1166143257 19:40817218-40817240 TTTAATCTTTAGTAGAGACAGGG - Intronic
1168225452 19:54991570-54991592 ACAAATCTTTAGAAAGGAATTGG + Intronic
927490157 2:23516070-23516092 TCTAAGCTCTAGGAGGGAGAGGG - Intronic
928784654 2:34868142-34868164 TCGAATCTTTATAAAGGAGAAGG - Intergenic
928937992 2:36700567-36700589 TTTAATTTTTAGTAGGGACAAGG - Intronic
929042498 2:37759139-37759161 TTTCATCTGTAAAAGGGAAATGG - Intergenic
929849294 2:45569016-45569038 TCAAATCTTTAAATGGGCAAGGG + Intronic
931879093 2:66547945-66547967 TCTGTTCTTCAGAAGGGTAAGGG - Exonic
932320279 2:70817190-70817212 TCTAACATTTCCAAGGGAAATGG + Intronic
932939471 2:76145673-76145695 TTAAATCTTTAGAAGGCAAATGG + Intergenic
933675791 2:85056308-85056330 TCTAATATTGAGAGGGAAAATGG - Exonic
933897423 2:86824429-86824451 TCTAATTTTTAGGAGGCCAAAGG + Intronic
934479233 2:94619488-94619510 TCTTATCTATAGAAAAGAAAAGG - Intergenic
935627344 2:105182045-105182067 TCTAATCTTTACAAGGCAGATGG - Intergenic
937527232 2:122786498-122786520 TCTAAGATTTAGAGGTGAAAAGG + Intergenic
937635449 2:124150890-124150912 GCTACTCTTCAGAAGGGACAGGG - Intronic
938123545 2:128653334-128653356 TATAAACTTTGGAAGGTAAAAGG - Intergenic
939797061 2:146658149-146658171 TCCTTTCTTTAGAAGGTAAAGGG - Intergenic
940357192 2:152755917-152755939 TCAAATTTTTAAAAGGGCAAAGG - Intronic
940372128 2:152915200-152915222 CCTCATCTATAGAAGGGCAAAGG - Intergenic
941550161 2:166905538-166905560 TCTCATTTTTACAAGGCAAATGG - Intronic
941817715 2:169814312-169814334 TTTAATCTTTAGTAGAGACAGGG - Intronic
942642022 2:178071015-178071037 TCTAATCTAGAGAAGGGAACAGG + Intronic
942907212 2:181198439-181198461 TGTACTGTGTAGAAGGGAAAGGG - Intergenic
943302145 2:186216613-186216635 CCTAATCTTAAGCAGGCAAATGG + Intergenic
943333334 2:186586506-186586528 TCTTATCTATGAAAGGGAAAGGG - Intergenic
943382801 2:187172081-187172103 TCTAATATGTAGTAGGGATATGG + Intergenic
944400763 2:199323586-199323608 TTTAATCTTTAAAAGAAAAAAGG + Intronic
944488939 2:200237743-200237765 TCTGTTCTTTATAATGGAAATGG - Intergenic
944739802 2:202600812-202600834 TTTAATCTTTAGTAGTGAAGGGG - Intergenic
944964975 2:204920812-204920834 TCCAATGTTTAGAAGGCAAAAGG - Intronic
944966929 2:204945472-204945494 TCTTATCTATAGAACAGAAAAGG + Intronic
945404416 2:209426882-209426904 TCTAAACATCAGAAGGGAAAAGG + Intronic
945985604 2:216351029-216351051 TCTAATCCATAGGAGGGGAAAGG + Intronic
946261641 2:218497243-218497265 TTTAATCTTTAGTAGAGACAGGG + Intronic
946623008 2:221578942-221578964 CATAATCTTTAGCAGGGAAAAGG - Intergenic
948112103 2:235464347-235464369 TTTAATCTTGGGAAGGGAATTGG + Intergenic
1169979401 20:11366349-11366371 TGTATTTTTTAGTAGGGAAAGGG + Intergenic
1170187559 20:13608025-13608047 TCTCAGCTTTAGAAGGTTAAAGG - Intronic
1173862731 20:46294755-46294777 GCTACTCTGTAGAAGGGAAGAGG + Intronic
1173970938 20:47151666-47151688 TCTAACCTTTTGAGGGGAATCGG - Intronic
1174550185 20:51356476-51356498 TCTCAGCCTTAGAAGGGAAGGGG + Intergenic
1174645741 20:52084162-52084184 ACTAATCTCTAGAGTGGAAAGGG - Intronic
1176801437 21:13434502-13434524 TTTAATTTTTAGTAGAGAAAGGG - Intergenic
1177702090 21:24652654-24652676 TCTATTTTTTAAAGGGGAAAAGG - Intergenic
1178164641 21:29959636-29959658 TCTAATTTTTAGGACTGAAAAGG + Intergenic
1182138756 22:27933354-27933376 TCGAAACTTAAGCAGGGAAAGGG - Intergenic
1183503089 22:38192934-38192956 TCTGAGCTTTAGAAGGCAAGGGG + Intronic
1184951407 22:47845057-47845079 TTTAATATTTAAAGGGGAAAGGG + Intergenic
1185102833 22:48850666-48850688 TCTTCTCTTTAGATGGAAAAGGG + Intronic
1203294687 22_KI270736v1_random:30633-30655 TTTCATCTGTAAAAGGGAAATGG - Intergenic
949261213 3:2104957-2104979 TCCAATCCTTAAATGGGAAACGG - Intronic
949370863 3:3333506-3333528 TCTAGTCTTTAAAATGGAAATGG - Intergenic
949504722 3:4716471-4716493 ACTACTATTCAGAAGGGAAATGG - Intronic
951092763 3:18594296-18594318 TCTGATCTATATGAGGGAAATGG + Intergenic
952982085 3:38744852-38744874 TCTGATCTGTGGAAGAGAAATGG - Intronic
953067830 3:39490880-39490902 TCTAATCATTTGAAGGCACAGGG + Intronic
953261338 3:41341870-41341892 TCTAATATTAAGAAATGAAATGG + Intronic
953778077 3:45840351-45840373 TCAAATCATTAGAGAGGAAATGG + Intronic
954827424 3:53386404-53386426 TATAAACTTTAGAGAGGAAATGG - Intergenic
955734098 3:62018398-62018420 AGTAAACTTTAGAAGGGAAACGG - Intronic
955786364 3:62544400-62544422 TCGAATCTTTGGAATGGGAAAGG + Intronic
956092285 3:65680591-65680613 TCTAATTTTTAGTAGAGACAAGG + Intronic
956426730 3:69144085-69144107 TCAGAACTTTAAAAGGGAAAAGG - Intergenic
956600141 3:71011848-71011870 TAATATCTTTAGAAGAGAAATGG + Intronic
958038767 3:88200984-88201006 TCTAAGCTTTTGAGGTGAAATGG + Intergenic
958679211 3:97305001-97305023 TCTAATATTTAGAATCTAAAAGG + Intronic
958780435 3:98534447-98534469 TCTAATATTTAGAAGTAAAATGG - Intronic
959082651 3:101818195-101818217 TTTAATTTTTAGAAGGAAAGGGG + Intronic
959155785 3:102664490-102664512 TAGAAACTATAGAAGGGAAATGG - Intergenic
959420554 3:106123113-106123135 ACTAATCGTCAGTAGGGAAAAGG - Intergenic
960199817 3:114818433-114818455 TATAATGTTTTAAAGGGAAAGGG + Intronic
960335207 3:116409417-116409439 TTTCATCTTTAAAAGGGAAATGG - Intronic
960732303 3:120740592-120740614 TCAAAATTTTATAAGGGAAATGG + Intronic
965615479 3:170587614-170587636 TCTCATCTTCAGAATGGGAAAGG + Intronic
966300830 3:178478068-178478090 TCTTATCTTTTGTGGGGAAAGGG - Intronic
967222850 3:187262777-187262799 CCTTATCTTTAGAAAGAAAAAGG + Intronic
967230168 3:187330462-187330484 TCTAATCTTTAAAATGAAAAAGG + Intergenic
967600234 3:191378182-191378204 CCAAATATTTAGAGGGGAAATGG - Intronic
967611271 3:191508879-191508901 TCTAATATTTAGAATGGAAGGGG + Intergenic
968151721 3:196342348-196342370 TCTAATTTTTAGTAGAGACAGGG + Intergenic
969148926 4:5151781-5151803 TCTCATCTGTAAAATGGAAAGGG + Intronic
969853608 4:9981490-9981512 ACTAATCTTTAGAAGAGAAATGG - Intronic
970187747 4:13479776-13479798 TCTAATTTTCAGCAAGGAAAAGG - Intronic
971520532 4:27545290-27545312 TTTAATCTTTGGAAAAGAAAGGG - Intergenic
971650831 4:29271278-29271300 TCTAACCTTTACAAAGAAAAAGG + Intergenic
971745696 4:30576946-30576968 ACTAATGTTAAGAAGGAAAAGGG + Intergenic
971810836 4:31424923-31424945 TTTTATCTATAGAAGAGAAATGG + Intergenic
971961846 4:33498764-33498786 TCAAATATTTGGAAAGGAAAAGG - Intergenic
972725993 4:41746696-41746718 TCTAATTGGTAGAAGGAAAAGGG + Intronic
973191339 4:47389247-47389269 TCAAATCTTAAGCAGGGAAGGGG - Intronic
974382148 4:61154839-61154861 TCAAATCCTCACAAGGGAAAGGG + Intergenic
974637660 4:64585678-64585700 CCTAATTGTTAGAATGGAAATGG - Intergenic
976761062 4:88549996-88550018 TCGAAACTTTAGCAGGGAAGGGG + Intronic
978260320 4:106748965-106748987 TTTCATCATGAGAAGGGAAAAGG + Intergenic
978449583 4:108817156-108817178 TCTTTTCTTTGGAATGGAAAGGG - Intronic
978994736 4:115136735-115136757 TTTAATTTTTAGAAGAGACAGGG - Intergenic
979338234 4:119488628-119488650 TCTAACCTGTAGAAGGGATGGGG - Intergenic
979761485 4:124410677-124410699 TCTAATCTTTAGTAAGCATATGG + Intergenic
979843753 4:125481539-125481561 CCTTATCATTAGAAGGCAAAGGG + Exonic
979874866 4:125875696-125875718 CCTATTTTTTAGAAGGTAAAAGG + Intergenic
980005759 4:127540694-127540716 TAAAATCTTAAGAAGGGAGAGGG + Intergenic
980375116 4:131936106-131936128 TCTAAACTTTACCAGGAAAAGGG + Intergenic
980398809 4:132252465-132252487 TGTAATCTTTAAAAGAGAAGTGG - Intergenic
983476989 4:168225383-168225405 TTTTTTCTTTAGAAAGGAAAAGG + Intronic
984242892 4:177238954-177238976 TTTAATTTTTAGAAGAGACAAGG - Intergenic
984971194 4:185192701-185192723 TCTGATCTTAAGAAGGTCAAAGG - Intronic
985131059 4:186739079-186739101 TCTAGTCCTGAGATGGGAAATGG + Intergenic
985306689 4:188550204-188550226 TATAACCACTAGAAGGGAAATGG + Intergenic
986031860 5:3902125-3902147 TGTAATTTTTAGAAGGGCCAAGG + Intergenic
987804452 5:22745181-22745203 TTTAATCTATAGAAGAGCAATGG - Intronic
988335663 5:29905638-29905660 TTTCATCTGTAGCAGGGAAAAGG - Intergenic
988477157 5:31596983-31597005 TCCAATCTTTAGAAACCAAAGGG + Intergenic
989465821 5:41754095-41754117 TTTAAGCTTTAGAAGGGAGCAGG - Intronic
990013635 5:51030715-51030737 TCTAATGTTGACAAGAGAAATGG + Intergenic
991595145 5:68296626-68296648 TCTCATCTTTAAAATGGAAGTGG + Intronic
991616201 5:68499297-68499319 TCTAATCTTTATAAAGGCACTGG + Intergenic
992846343 5:80752749-80752771 TGTAATTATTAGTAGGGAAAGGG + Intronic
994391812 5:99199553-99199575 TGTAATATTCAGAAGGGAAGAGG - Intergenic
994394894 5:99219473-99219495 TCTAATATCCAGAAGGGGAAAGG - Intergenic
995044879 5:107634342-107634364 TCTAATCTTTTGTAGAGACAAGG - Intronic
995238343 5:109856885-109856907 TCTAAGCTCTAGAAGGGCAGGGG - Intronic
995629207 5:114114961-114114983 ACTAATATTGTGAAGGGAAAAGG - Intergenic
996399140 5:123041775-123041797 ACAATTCTTAAGAAGGGAAAAGG - Intergenic
996588230 5:125115702-125115724 TTTCACCTTTAGAAGAGAAAAGG - Intergenic
996794319 5:127327887-127327909 TCTAATTTTTAGTAGAGACAGGG + Intronic
997915526 5:137920984-137921006 TCTAATGTTTAGAAGGGCACAGG + Intronic
999640050 5:153663303-153663325 CCTAATCCTTAGAATGGGAAAGG - Intronic
999933521 5:156459806-156459828 GCTAATCTGTAGAAGGAAACAGG - Intronic
1001301674 5:170538081-170538103 TCTCATCTTTAAAATGGGAAAGG - Intronic
1001439369 5:171727727-171727749 TCTAATCTGTAGAAAAGAGAGGG + Intergenic
1002281568 5:178133170-178133192 TCTAATCTTTGTCAGGCAAAAGG + Intronic
1004168485 6:13277118-13277140 TCCAAGGTTCAGAAGGGAAATGG + Intronic
1004343805 6:14830199-14830221 TCTTTTCTTTAGAGAGGAAAAGG - Intergenic
1006135464 6:31893130-31893152 TCTCATCTGTAAAATGGAAAAGG - Intronic
1007500784 6:42295170-42295192 TCAAATATTTAGAAGGGTGAAGG - Intronic
1007803194 6:44415652-44415674 TGTGTTCTTAAGAAGGGAAAGGG - Intronic
1009365257 6:62852914-62852936 CCTAATATCCAGAAGGGAAAAGG + Intergenic
1009368575 6:62875111-62875133 CCTAATATTCAGAAGGGAAGAGG + Intergenic
1009368786 6:62876782-62876804 CCTAATATTTAGGAGGGAAGAGG + Intergenic
1009593511 6:65705749-65705771 TTTACTATTTAGAAAGGAAAAGG - Intronic
1009759183 6:67981147-67981169 TCTTATTTTTTGAAGGGAAGAGG + Intergenic
1009907209 6:69884736-69884758 TCTAATTTTTGGAAGGAGAAGGG + Intronic
1009950708 6:70392378-70392400 TCTAACCTCTACCAGGGAAATGG - Intergenic
1009974463 6:70658331-70658353 TCTAATCTTAAGTGGGGAAAAGG + Intergenic
1010510475 6:76712474-76712496 TCTAATTTTTAGTAGAGACAGGG - Intergenic
1010515713 6:76770681-76770703 TCTTATCTGTAGAAGAGGAAAGG - Intergenic
1010615217 6:78004989-78005011 TGTATTCTTTTGCAGGGAAATGG - Intergenic
1011119916 6:83941297-83941319 TCAAATCTTTTTAGGGGAAATGG - Intronic
1011755175 6:90491352-90491374 TTTAATCTTTAGTAGAGACAGGG - Intergenic
1012659441 6:101869006-101869028 TCTAATTTTGTCAAGGGAAAGGG + Intronic
1013234533 6:108185771-108185793 TTTATTCTTTAGTTGGGAAAGGG - Intronic
1013382100 6:109584299-109584321 GCTAATATTTGAAAGGGAAAAGG + Intronic
1014399493 6:120970032-120970054 TCAAATTTTTAAAAGGGCAAAGG + Intergenic
1014546088 6:122737699-122737721 TCCAATTTTTAGTAGGAAAATGG - Intergenic
1014937606 6:127402439-127402461 TTTATTCATTAAAAGGGAAAAGG - Intergenic
1016189184 6:141240105-141240127 TCAAATCCTTTGAAGGGACATGG + Intergenic
1016776769 6:147913102-147913124 TTAAATCTTTAGAGAGGAAAAGG + Intergenic
1018975118 6:168558563-168558585 TCTCATCTTTAAAATGGTAATGG + Intronic
1019081440 6:169433395-169433417 TCTGATCTTTTGCAGGGACATGG - Intergenic
1020692685 7:11376384-11376406 GCTCATCTTTAGAAACGAAATGG + Intronic
1020705502 7:11538822-11538844 CCTCCTCCTTAGAAGGGAAATGG + Intronic
1021152677 7:17170250-17170272 TATAAACTATAGAAGTGAAAAGG + Intergenic
1021168102 7:17365023-17365045 TATAATCTTTATAAGTGATATGG + Intergenic
1022623229 7:32006600-32006622 TCTTATCCTTCTAAGGGAAATGG - Intronic
1022684138 7:32578898-32578920 CCTAATCTTTAGGAGTTAAAGGG - Intronic
1023003966 7:35842483-35842505 TCAAATTTTTAGCAGGGAAGGGG + Intronic
1023705138 7:42933047-42933069 TCTAATCATTAGGAAGGATAGGG - Intronic
1025017142 7:55448950-55448972 TGTAATCCTTAGCAGGGAAGAGG + Intronic
1025219764 7:57097223-57097245 TCAAATTTTTAGCAGGGAAGGGG - Intergenic
1025630547 7:63268770-63268792 TCAAATTTTTAGCAGGGAAGGGG - Intergenic
1026071685 7:67127330-67127352 TTTAATCTTTAGTAGAGACAGGG + Intronic
1026444370 7:70471273-70471295 ACCAATCTTTAGAAAGAAAAGGG + Intronic
1026958446 7:74393198-74393220 GCTAATTTTTAGTAGGGACAGGG + Intronic
1026963944 7:74427362-74427384 GCTAATTTTTAGGAGGGACAGGG - Intergenic
1027388540 7:77682291-77682313 TTTAATTTTTAGTAGAGAAAAGG + Intergenic
1027518058 7:79167349-79167371 TCTCATATTAAGAAGGAAAAAGG - Intronic
1028750468 7:94376861-94376883 TTTAATCTTTAGTAGAGACAGGG - Intergenic
1029242950 7:99177408-99177430 GCTAATCTTTAGTAGAGACAGGG - Intronic
1029292644 7:99514195-99514217 TCTAATTTCAAAAAGGGAAATGG - Intronic
1029343021 7:99959792-99959814 TGTAATATTTAGAAGGGGAGAGG + Intergenic
1029790300 7:102836430-102836452 TCTTATCTGTAGGGGGGAAATGG - Intronic
1030034339 7:105395771-105395793 TCTAATTTATAGAAGTAAAAAGG - Intronic
1030408603 7:109146035-109146057 TCAAATCTTTGAAAGGGACAAGG + Intergenic
1031802703 7:126269088-126269110 CCTAATTTTAAAAAGGGAAAAGG + Intergenic
1032198628 7:129804227-129804249 TTTCATCTTTGCAAGGGAAATGG - Intergenic
1032276992 7:130466496-130466518 TTTAATATGTAGAAGGAAAACGG - Intergenic
1032878249 7:136061016-136061038 AATAATCTTTAAAAGGGTAAAGG - Intergenic
1032995781 7:137445020-137445042 TCAAATCCATAGCAGGGAAATGG + Intronic
1034133056 7:148738842-148738864 ACTAATCTTTAGGAGAAAAATGG - Intronic
1036055433 8:5247573-5247595 TCTAATCCTTAGAAAAGACAGGG + Intergenic
1036599516 8:10247523-10247545 TCTTATGTTTAGAAGGAAAAAGG + Intronic
1037404482 8:18526804-18526826 TCTAATATTTAGAAGTGAATAGG + Intergenic
1037648026 8:20811396-20811418 ACTCATCTTTAGAGAGGAAAAGG - Intergenic
1039126916 8:34213904-34213926 TCTCATCCTTAAAATGGAAAAGG - Intergenic
1041436085 8:57843336-57843358 TCCAACCTTCAGAAGGTAAAAGG - Intergenic
1041572474 8:59352891-59352913 GCTAATTTTTAGTAGAGAAAGGG + Intergenic
1041776219 8:61526095-61526117 TCTAGTCTTTAGAAAGAAACTGG - Exonic
1042425572 8:68644062-68644084 CCAAATGTTTAGAAGGTAAAGGG - Intronic
1042988087 8:74605428-74605450 TGTGACATTTAGAAGGGAAATGG + Intronic
1043124862 8:76379280-76379302 TCTAATTTTTAGAAGGTATTAGG + Intergenic
1043464908 8:80495092-80495114 TCTAATATTTGGGAGGGAGAAGG + Intronic
1043525135 8:81088298-81088320 ACTATTCTTTTGAAGGGTAATGG - Intronic
1044659063 8:94578015-94578037 TCTTTTCTTTTGGAGGGAAAGGG + Intergenic
1046336555 8:112796690-112796712 ACTAATGTTTCTAAGGGAAATGG + Intronic
1046392678 8:113596877-113596899 TTTAATCCTTAGAATGGAGAAGG - Intergenic
1046437897 8:114217509-114217531 TCTTATTTTTAAAAAGGAAACGG + Intergenic
1046534438 8:115491125-115491147 TCTAATTATTACAAGGTAAAGGG - Intronic
1046728189 8:117696672-117696694 TCTAATCAATAGAAAGGAAAAGG - Intergenic
1046863702 8:119122787-119122809 TCTAATTTTTAGAATAGAATAGG + Intergenic
1048524912 8:135193566-135193588 TCTAATCTTTTAAAAGAAAAGGG + Intergenic
1048956505 8:139541570-139541592 GCTAATCTATAGTAGGGAACAGG + Intergenic
1049317217 8:141975650-141975672 TCTGATCTGTTGAGGGGAAATGG - Intergenic
1049733324 8:144190353-144190375 GCTAATTTTTAGAAGAGACAGGG - Intronic
1049921057 9:364662-364684 TTTAATGTGTAGAAGGGAAAAGG + Intronic
1050645141 9:7711646-7711668 TGTAATCTTTAGTAGGCAACTGG + Intergenic
1051291634 9:15551758-15551780 TCTAAAGTTTAGAAATGAAATGG - Intergenic
1051882450 9:21853283-21853305 TCTTAACTTTAGGGGGGAAAAGG + Intronic
1052358892 9:27533005-27533027 TTTACTATTTAGAAGAGAAAGGG - Intergenic
1053678593 9:40464077-40464099 TCTTATCTATAGAAAAGAAAAGG + Intergenic
1053928579 9:43092431-43092453 TCTTATCTATAGAAAAGAAAAGG + Intergenic
1054285131 9:63160865-63160887 TCTTATCTATAGAAAAGAAAAGG - Intergenic
1054291671 9:63299615-63299637 TCTTATCTATAGAAAAGAAAAGG + Intergenic
1054389687 9:64604158-64604180 TCTTATCTATAGAAAAGAAAAGG + Intergenic
1054506025 9:65912218-65912240 TCTTATCTATAGAAAAGAAAAGG - Intergenic
1055036453 9:71823449-71823471 TCAAACCTTGAGAAGGGGAAAGG + Intergenic
1055417531 9:76099646-76099668 TCTGATATCTAGAAGGAAAAGGG - Intronic
1055676007 9:78661973-78661995 TCTTACCATTTGAAGGGAAATGG - Intergenic
1056342977 9:85656168-85656190 TCTAATCTGGAGAAGGGTTAAGG + Intronic
1057537306 9:95924781-95924803 TTTAATTTTTAGGAGGGAAAAGG + Intronic
1058054680 9:100437293-100437315 TCTAATCATCAGCCGGGAAAGGG - Intronic
1059692989 9:116703755-116703777 TCTACTCTGTAGGAGGGAAGTGG + Intronic
1059820191 9:117963947-117963969 TCTCATCATTAGAAAGGAAATGG + Intergenic
1060488935 9:124067831-124067853 TCTAATCTGTAGGGGAGAAATGG + Intergenic
1061515712 9:131088907-131088929 TTATATCTTTAGAAGGGACAGGG - Intronic
1062066417 9:134529365-134529387 TGTAATTTTTAAAAGGGAAAAGG - Intergenic
1062680960 9:137779943-137779965 TCTAATTTTTAAAAAGGAATTGG + Intronic
1185860771 X:3577227-3577249 ACTAATCTTAGGAAGGGCAAAGG - Intergenic
1186131039 X:6465541-6465563 CCTAGTCTTTAGAAAGGGAAAGG - Intergenic
1186462911 X:9762876-9762898 TTTAGCCTTTAGAAGGGAAGTGG - Intronic
1186468854 X:9805561-9805583 TTTAATCTTTAGTAGAGACAGGG - Intronic
1187210219 X:17222902-17222924 CCTAATCATTAGAAGGGGAAAGG - Intergenic
1187271107 X:17780512-17780534 TCCAATGTTTAAAAGGAAAATGG + Intergenic
1188800565 X:34524738-34524760 TCTTATCTTGAGCAGGTAAAAGG - Intergenic
1189766082 X:44373380-44373402 TCTACTCTATAGAATGGTAAAGG + Intergenic
1190454058 X:50608177-50608199 TCTGATGTTTTGCAGGGAAATGG - Exonic
1192770784 X:74187134-74187156 TCTACTGTTTAGAAGGAAATGGG - Intergenic
1192938947 X:75892817-75892839 TCTTCTCTTTAGAGGGGATAGGG + Intergenic
1193962003 X:87938013-87938035 TCTTATGTTTTGAGGGGAAAAGG - Intergenic
1197316853 X:124977146-124977168 TTTAATCTTTAGTATGAAAAAGG - Intergenic
1198183753 X:134235024-134235046 TTTAATTTTTAGTAGAGAAAGGG - Intergenic
1198712329 X:139518741-139518763 ACCAATCTTTAGGAGTGAAAGGG + Intergenic
1202151692 Y:21849572-21849594 TTTAATATTTTAAAGGGAAATGG + Intergenic
1202240295 Y:22760079-22760101 TCTAATTTTTAGTAGAGACAAGG - Intergenic
1202393281 Y:24393833-24393855 TCTAATTTTTAGTAGAGACAAGG - Intergenic
1202477504 Y:25276267-25276289 TCTAATTTTTAGTAGAGACAAGG + Intergenic