ID: 1106612548

View in Genome Browser
Species Human (GRCh38)
Location 13:31297616-31297638
Sequence CAATTTTAACACTGTCTACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 902
Summary {0: 1, 1: 1, 2: 68, 3: 257, 4: 575}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106612546_1106612548 -2 Left 1106612546 13:31297595-31297617 CCAAATGGGTGTCCTTTAATTCA 0: 1
1: 1
2: 37
3: 228
4: 615
Right 1106612548 13:31297616-31297638 CAATTTTAACACTGTCTACCTGG 0: 1
1: 1
2: 68
3: 257
4: 575
1106612542_1106612548 28 Left 1106612542 13:31297565-31297587 CCAAGCAATCAATCAGTTCTGCA 0: 1
1: 14
2: 75
3: 86
4: 257
Right 1106612548 13:31297616-31297638 CAATTTTAACACTGTCTACCTGG 0: 1
1: 1
2: 68
3: 257
4: 575

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106612548 Original CRISPR CAATTTTAACACTGTCTACC TGG Intronic
900708678 1:4097040-4097062 CAGTTCTGACACTGTCTACCCGG + Intergenic
900845480 1:5096870-5096892 CAATTCTGACACTATCTCCCTGG - Intergenic
901086921 1:6616053-6616075 GAATCTTAGCTCTGTCTACCGGG + Intronic
901369256 1:8782541-8782563 CCATCTTAAAACTGTCTACTTGG + Intronic
901385210 1:8903696-8903718 CAATTTCAACACTATCTACCTGG - Intergenic
901488061 1:9579253-9579275 CACTTCCGACACTGTCTACCAGG + Intronic
901886160 1:12224730-12224752 CAATTCTGACACTACCTACCTGG + Intergenic
902313070 1:15596833-15596855 CAATCCTGACACTATCTACCTGG - Intergenic
904056777 1:27676003-27676025 CAATTCTGACACTGTCTACCTGG + Intergenic
904218264 1:28942240-28942262 CAATTCTGACACTATCTACCTGG + Intronic
904551397 1:31322216-31322238 CAATTCTGACACTAACTACCTGG + Intronic
905233954 1:36532740-36532762 CAATTCTGACACCATCTACCTGG - Intergenic
905235849 1:36547627-36547649 CAATTCTGACACTGTCTACTTGG + Intergenic
905250747 1:36646731-36646753 CAATTCTGACAGTATCTACCAGG + Intergenic
905582542 1:39093221-39093243 CAATTACAACACTGTCTACCTGG + Intronic
905692073 1:39950853-39950875 CAATTCCAACACTACCTACCTGG + Intergenic
905764230 1:40586882-40586904 GAATTCTAATACTATCTACCTGG + Intergenic
906482719 1:46210413-46210435 TAATTTCAACTCTGTCTACCTGG + Intronic
907232344 1:53011702-53011724 CAATTCTAACACTATTTACCTGG - Intronic
907818128 1:57939949-57939971 AAATTTTAATTTTGTCTACCTGG + Intronic
908293901 1:62694029-62694051 CAGTTCTGACACTGTCTACCTGG + Intergenic
908505235 1:64790855-64790877 CAATTCTAGCACTAACTACCTGG + Intronic
908560477 1:65301379-65301401 CAATTCTGAAACTATCTACCAGG + Intronic
908727611 1:67193813-67193835 CAATTCTGACTCTGTCTACCTGG + Intronic
909281181 1:73755766-73755788 CAATTCTGATACTGTCTACCTGG + Intergenic
910102909 1:83597919-83597941 CAATTCTGACACTGTCTTCCTGG + Intergenic
910582943 1:88848266-88848288 CAATTCTGCCACTGTTTACCTGG - Intergenic
911120011 1:94286926-94286948 CAATTCCAACACTATCAACCTGG + Intergenic
911352503 1:96772044-96772066 CAGTTTCAACACTGTCTGCCGGG + Intronic
911952019 1:104185199-104185221 CAATTCTGACACTCTCTACCTGG - Intergenic
913187789 1:116385725-116385747 CAATTCCAACACTATCTACCTGG - Intronic
913671838 1:121104558-121104580 CAATTTTTACACTATTTATCAGG + Intergenic
914406450 1:147378889-147378911 AAATTCCAACACTCTCTACCTGG + Intergenic
914662088 1:149799948-149799970 CAATTTTTACACTATTTATCAGG + Intronic
914698867 1:150112634-150112656 CAATTCTGACACGATCTACCTGG + Intronic
915183469 1:154083571-154083593 CAATTCTGACACTATCTACCTGG - Intronic
915727316 1:158027006-158027028 CAACTCTGACACTATCTACCTGG + Intronic
915962178 1:160275957-160275979 TAATTCTGACACTGTCTACCTGG - Intergenic
916301031 1:163274702-163274724 CAATTTGGACACTATCTACCTGG - Intronic
916462773 1:165044508-165044530 CAATTCTGACACTATCTACCTGG + Intergenic
916480474 1:165209937-165209959 TAATTCTGACACTCTCTACCTGG - Intronic
916531401 1:165660138-165660160 CAATTCTGACACTATCTACCTGG + Intronic
916536467 1:165708435-165708457 CAATTGTCACACTGTCTGTCCGG - Intergenic
916550490 1:165845158-165845180 CAATTCTGACACGATCTACCTGG - Intronic
917228704 1:172813002-172813024 CAATTCTGACTCTGTCTACTTGG - Intergenic
917412183 1:174770532-174770554 CAATTTAATCACTGACTACTTGG - Intronic
918019871 1:180677075-180677097 CAATTCTGACACTGACTACCTGG + Intronic
918075499 1:181168114-181168136 CAATTCGGACACTGTCTACCTGG - Intergenic
918141433 1:181723541-181723563 CAATTCTGACGCTATCTACCTGG + Intronic
918566781 1:185943360-185943382 CAGTTCTGACACTATCTACCTGG - Intronic
918807185 1:189063646-189063668 AAATTTTACCATTGTCTCCCAGG - Intergenic
919493120 1:198229552-198229574 CAATTCCAACACTATCTTCCTGG - Intronic
919678781 1:200412159-200412181 CAATTCTGACACTACCTACCTGG - Intergenic
919974952 1:202604292-202604314 CTAGTATAACACCGTCTACCTGG - Intronic
920720193 1:208380001-208380023 CAGTTCTAACACTGTCTACCTGG - Intergenic
920793050 1:209110914-209110936 CAATTGTGACACTATCTACCTGG - Intergenic
920936604 1:210440710-210440732 CAATTTCAACACTGTGTACCTGG + Intronic
921244343 1:213220801-213220823 CAATTCTAACACTGAATAACTGG - Intronic
921436884 1:215134231-215134253 CAATTCTGACACTGTCTACCTGG + Intronic
921467645 1:215509315-215509337 CAATTCTGACACTGTCTACCTGG + Intergenic
921584896 1:216935199-216935221 CAATTCTGACACTCCCTACCTGG + Intronic
921674461 1:217962758-217962780 TAATTCTGATACTGTCTACCTGG - Intergenic
921768099 1:218997315-218997337 CAATTCTAACACCAACTACCTGG - Intergenic
922006328 1:221534357-221534379 CAATTCTGACACTACCTACCTGG + Intergenic
922333425 1:224597929-224597951 CAATTCTGACACTGTGTACCTGG - Intronic
922601423 1:226857664-226857686 CAATTCTGACACTACCTACCTGG - Intergenic
922704639 1:227782835-227782857 CCCTTTTTACACTTTCTACCTGG - Intergenic
922754373 1:228086883-228086905 CAATTCTGACACTGTCTACCTGG - Intronic
922761393 1:228134098-228134120 CAATTCTAACACTATCTACCTGG + Intergenic
922770341 1:228178636-228178658 CAGTTTCTACACTGTCTGCCGGG - Exonic
922805249 1:228383325-228383347 CAATTCCAACACTGTCTACCTGG + Intergenic
922966820 1:229697514-229697536 CAATTCCCACACTGTCTACCTGG + Intergenic
923025364 1:230199589-230199611 CACTTTTAACACTGTGACCCAGG - Intronic
923074539 1:230598073-230598095 GAATTCTGACACTGTCTACCTGG + Intergenic
923426188 1:233872339-233872361 CAAATATAACCATGTCTACCTGG + Intergenic
923916360 1:238510460-238510482 CAACTCCAACACTGTCTACCTGG - Intergenic
924063220 1:240197544-240197566 CAATTCTAACACTATCTACCTGG - Intronic
924143993 1:241055200-241055222 CAATTCGGACACTATCTACCCGG + Intronic
924236009 1:242000132-242000154 CAACTCTGACACTGTCTACCTGG + Intergenic
924417240 1:243869705-243869727 CAATTCTGACTCTATCTACCTGG - Intergenic
924469694 1:244331029-244331051 CAATTCTGACAGTATCTACCTGG - Intergenic
924609741 1:245563840-245563862 CAAGTTCAACACTGTCTCCCGGG - Intronic
924824497 1:247525284-247525306 CAGTTTTGACACTATCTACCTGG + Intronic
1063869904 10:10405740-10405762 CAATTCTGACACCCTCTACCTGG - Intergenic
1064655540 10:17551891-17551913 CAGTTTTGACACTATCTACCTGG - Intergenic
1064979297 10:21149822-21149844 CAATTCCAACCCTATCTACCTGG - Intronic
1065053610 10:21820594-21820616 CAATTCTGACCCTATCTACCTGG + Intronic
1065213826 10:23430794-23430816 TAATTCTGACACTATCTACCTGG + Intergenic
1065355928 10:24841811-24841833 CAGTTCTAACACTAACTACCTGG + Intergenic
1065468047 10:26046254-26046276 CAATTCTGTCACTATCTACCTGG - Intronic
1065768347 10:29053270-29053292 CAATTCTGATACTGTCTACCTGG + Intergenic
1065872308 10:29966001-29966023 CAATCTTTCCACTCTCTACCTGG - Intergenic
1065935779 10:30519447-30519469 CAATTCCACCACTATCTACCTGG + Intergenic
1067133953 10:43592033-43592055 CAATGTTACCACTGCATACCTGG + Intergenic
1067299733 10:44997509-44997531 CAGTTTTGACACTATCTACTTGG + Intergenic
1067859622 10:49831989-49832011 CAAATCTGACACTGACTACCTGG - Intronic
1068758688 10:60683039-60683061 CAGTTCTGACACTGTCTACCTGG - Intronic
1069176801 10:65300256-65300278 CAATTCTGACACTGTCTACCTGG - Intergenic
1069375546 10:67789074-67789096 TAATTGTGACACTGTCTACCTGG + Intergenic
1069763273 10:70831323-70831345 CAATTCTGACACTGTCTACCTGG + Intronic
1070083426 10:73210991-73211013 CAGTTCTGACACAGTCTACCAGG + Intronic
1070304018 10:75227394-75227416 CAATTCTGATACTATCTACCTGG - Intronic
1070522280 10:77264538-77264560 CAATTCTTTCACTGTGTACCTGG - Intronic
1071282841 10:84118417-84118439 CAATTATGATACTGTCTCCCTGG + Intergenic
1071617270 10:87086958-87086980 CAGTTATGACACTGACTACCAGG + Intronic
1071662468 10:87518597-87518619 CAGATTTGACATTGTCTACCTGG + Intronic
1071664820 10:87544017-87544039 TAATTTTGACACTATCTGCCTGG + Intronic
1071859594 10:89658678-89658700 CAGTTCTTACACTGGCTACCTGG + Intergenic
1072350937 10:94556153-94556175 CAATTCTGACACTATCTACGGGG - Intronic
1072594823 10:96861852-96861874 CAATTCCAACACTATCTACCTGG + Intronic
1073232518 10:101984011-101984033 CAATTCTGACACTATCTACCTGG - Intronic
1074695709 10:116048736-116048758 CATTTTTGAGACTGTCTTCCAGG - Intergenic
1075240080 10:120770400-120770422 TTATTTTAACACTGTGTATCTGG - Intergenic
1076041496 10:127253432-127253454 CAATTCTGACACCATCTACCTGG + Intronic
1076111826 10:127865550-127865572 CACTTCTGACACTATCTACCTGG - Intergenic
1076426421 10:130370473-130370495 TAATTTTAACACAGCCTACCTGG + Intergenic
1076859725 10:133135129-133135151 CATTTTAAACAGTGTTTACCAGG - Intergenic
1077086248 11:752939-752961 CAATTCCAACCCTGTCTACCTGG - Intronic
1078257564 11:9673075-9673097 CAATTCCAACACTATCTACCTGG + Intronic
1078346549 11:10554687-10554709 AAATTCTGACACTATCTACCTGG - Intergenic
1078379055 11:10823126-10823148 CAATTCCAACACTATCTACCTGG - Intronic
1078658415 11:13263842-13263864 CCATTTCATCACTCTCTACCTGG - Intergenic
1078814761 11:14809093-14809115 AAATTTTAAAACTTACTACCAGG + Intronic
1078872166 11:15357714-15357736 CAGTTCTGACACTGTCTACCCGG - Intergenic
1079442316 11:20527379-20527401 GAAGTTTAAAACTGTCTACGTGG + Intergenic
1079769166 11:24437285-24437307 CAATGCTGACACTATCTACCTGG + Intergenic
1080301280 11:30788038-30788060 CAATTCTTACACTATCTACCTGG + Intergenic
1080335942 11:31196331-31196353 CAATTCTGACACTAACTACCTGG + Intronic
1080350707 11:31382773-31382795 CAGTTCTGACACTGTTTACCTGG + Intronic
1080674402 11:34411445-34411467 CAATTCTGACACTATCTACTTGG - Intergenic
1080723581 11:34872774-34872796 CAATTTCAACAATATCTAACTGG - Intronic
1080823565 11:35829290-35829312 CAATTATGACACTATCTACCTGG + Intergenic
1080999958 11:37656410-37656432 CAGTTCAGACACTGTCTACCTGG - Intergenic
1081329351 11:41785203-41785225 CAATTCTGACACTATCCACCTGG - Intergenic
1081471022 11:43371246-43371268 CAGTTCTGACATTGTCTACCTGG + Intronic
1081472863 11:43393158-43393180 CAATTCTGACACTAACTACCTGG + Intronic
1081499505 11:43652457-43652479 CAATTCCGACACTATCTACCTGG + Intronic
1081927223 11:46840965-46840987 CAATTCTGACACTTTCTATCTGG - Intronic
1081951996 11:47052385-47052407 CAGTTTTAACAGTGTATGCCAGG + Exonic
1082704520 11:56477256-56477278 CAGTTCTGACACTATCTACCTGG - Intergenic
1083452793 11:62757344-62757366 TAATGCCAACACTGTCTACCTGG + Intergenic
1083699734 11:64468038-64468060 CAATTCTGACACTATCTACCTGG - Intergenic
1083703225 11:64495075-64495097 CAATTCTGACGCTGTCTACCTGG + Intergenic
1083788608 11:64969607-64969629 CACTTTTATCACTGTAGACCTGG - Intronic
1083918342 11:65765017-65765039 CAATTCTGACACCATCTACCTGG - Intergenic
1084156497 11:67316016-67316038 CAATTCCAACTCTGTCTACCGGG - Intergenic
1084338119 11:68473661-68473683 CAATTCCAACACCATCTACCTGG - Intronic
1084993737 11:72955069-72955091 CAATTCTGACACTCTCTTCCTGG + Intronic
1085148453 11:74226092-74226114 TTATTTTTTCACTGTCTACCTGG + Intronic
1085487575 11:76880440-76880462 CAATTCTGACACTGTCTACTTGG + Intronic
1085693749 11:78686607-78686629 CAATTCCAACACTATCTACCTGG - Intronic
1086363833 11:86088123-86088145 CAATTCTGACACTAACTACCTGG - Intergenic
1086470331 11:87102113-87102135 TAATTCTAATACTGTCTACCTGG + Intronic
1086598379 11:88602691-88602713 AAATTTTAACTCTGTCTCCTGGG - Intronic
1087036860 11:93764880-93764902 CAATTCTAACACTATTTACTTGG + Intronic
1087206145 11:95396845-95396867 CAATTTTAACAATCCCTTCCAGG + Intergenic
1087419030 11:97897139-97897161 CAATTTTGGCACTAACTACCTGG - Intergenic
1088038998 11:105353677-105353699 CAATTCTGACACTAGCTACCTGG + Intergenic
1088205121 11:107383308-107383330 CAGTTCCAACACTGTCTACCTGG - Intronic
1088784005 11:113164374-113164396 CATTTCTGACACTGTCTACCTGG + Intronic
1089235512 11:117021015-117021037 CAGTTCTGACACTGTCTACCTGG - Intronic
1089736277 11:120552224-120552246 CAACTCCAACACTGTCTACCTGG - Intronic
1089970531 11:122689629-122689651 CAGTTCCAACACTGTCTACCTGG + Intronic
1090197890 11:124832646-124832668 CAATTCTAACACCTTCCACCTGG + Intergenic
1090289448 11:125529067-125529089 CAATTCTGACGCTGTTTACCTGG - Intergenic
1090417521 11:126550861-126550883 CAATTCTGACACTGTCTACCTGG + Intronic
1090493818 11:127190618-127190640 CAACTCTGACACTGTCTATCTGG + Intergenic
1090550684 11:127816520-127816542 CAATTTTAACACTGTGCAGATGG + Intergenic
1090556097 11:127878229-127878251 CAATTCTCACATTATCTACCTGG + Intergenic
1091137569 11:133205558-133205580 CAATTCTGACACTGTCTACCTGG - Intronic
1091446137 12:545202-545224 CCATCTTCACACTGTCTCCCAGG + Intronic
1092346341 12:7718189-7718211 CAATTCCAGCACTGTCTACCTGG + Intergenic
1092372140 12:7925413-7925435 TAATTATGACACTGTCTACCTGG - Intronic
1092546532 12:9456970-9456992 CAATTGTGACACCGCCTACCTGG + Intergenic
1093164825 12:15792057-15792079 CAATTCTGAAACTATCTACCTGG - Intronic
1093425544 12:19024344-19024366 CAATTCTGACACTATCTACCTGG - Intergenic
1093553896 12:20447896-20447918 CAATCCTAACACTATCCACCTGG - Intronic
1093762423 12:22925261-22925283 CAATTCTGACACCATCTACCTGG + Intergenic
1094019908 12:25903168-25903190 AAAATTTACCACTTTCTACCAGG + Intergenic
1094443704 12:30507294-30507316 CAATTCCAACACTATCTACCTGG + Intergenic
1094481104 12:30882070-30882092 CAATTCCAACACTATCTACCTGG - Intergenic
1094506410 12:31065112-31065134 CAATTGTGACACCGCCTACCTGG - Intergenic
1094577416 12:31699838-31699860 CAATTCTGACACTATCTACCTGG - Intronic
1094686496 12:32721670-32721692 CAATGCTAACACTGTTTACCTGG + Intronic
1094756015 12:33469290-33469312 CATTTAGAACACTGTCTACTTGG - Intergenic
1095482709 12:42652302-42652324 CAATTCTGACAATATCTACCTGG - Intergenic
1095672723 12:44878797-44878819 AAATTTTAACATTGTCTAAAAGG - Intronic
1095730985 12:45506461-45506483 CAATTCCAACACTATCTACCTGG - Intergenic
1095786814 12:46119011-46119033 CAACTCTGACACTGTCTACTTGG - Intergenic
1095861558 12:46923626-46923648 CAACTCTAATACTGTCTACCAGG + Intergenic
1097138013 12:56875566-56875588 CAATTCTAATACTACCTACCTGG - Intergenic
1097636438 12:62128151-62128173 CAATTTTATCACTGCCTTCTAGG + Intronic
1097729834 12:63116147-63116169 CGATTCCAACACTATCTACCTGG + Intergenic
1098132275 12:67363088-67363110 CAATTATGACACTATGTACCTGG - Intergenic
1098296687 12:69011232-69011254 CGGCTCTAACACTGTCTACCTGG + Intergenic
1098416180 12:70237668-70237690 CAGTTCTGACACTATCTACCTGG - Intergenic
1098493294 12:71106890-71106912 CAATTTTGACACTATCTACCTGG - Intronic
1098825223 12:75287946-75287968 CAATTCTGACATTATCTACCTGG - Intronic
1099371057 12:81830104-81830126 CCATTCTGACACTATCTACCTGG - Intergenic
1099724358 12:86406897-86406919 CAATTCTAATGCTATCTACCTGG + Intronic
1100232174 12:92619599-92619621 CAATTCTGACACTATCTACCTGG + Intergenic
1100411836 12:94326488-94326510 CAATTCTGAAACTATCTACCTGG - Intronic
1100537345 12:95523385-95523407 TAGTTCTGACACTGTCTACCTGG - Intronic
1101582113 12:106050757-106050779 CAATTCCAACACTATCTACCTGG + Intergenic
1101772796 12:107767141-107767163 TAATTCCAACACTATCTACCTGG + Intergenic
1102279634 12:111608719-111608741 CAATTCTGGCACTATCTACCTGG - Intergenic
1102840643 12:116116718-116116740 CAATTCTGACACTGTCTACCTGG - Intronic
1103176669 12:118869920-118869942 CAATTCTGACACTATCTACCTGG - Intergenic
1103986325 12:124769835-124769857 CAATTCTGCCGCTGTCTACCTGG - Intergenic
1104268935 12:127264664-127264686 AAATTCCAACACTATCTACCTGG + Intergenic
1105513196 13:21068148-21068170 CAATTCTGACACTATCTACCTGG - Intergenic
1105531239 13:21222354-21222376 CAGTTCTGACACTGTCTACCTGG - Intergenic
1106114864 13:26808727-26808749 CAATTCTAACACTATCTACTAGG + Intergenic
1106217602 13:27717113-27717135 CAATTCTGACTCTGCCTACCTGG - Intergenic
1106371360 13:29136938-29136960 CCATTCTGATACTGTCTACCTGG - Intronic
1106427950 13:29651019-29651041 CAATACTGACACTATCTACCTGG - Intergenic
1106612548 13:31297616-31297638 CAATTTTAACACTGTCTACCTGG + Intronic
1107516999 13:41138872-41138894 CAATTCTGACACTGTCTACCTGG - Intergenic
1108221697 13:48240830-48240852 TAATTTTAAGTCTGTATACCTGG + Intronic
1108834674 13:54528158-54528180 CAATTTTGCCACTATCTTCCTGG + Intergenic
1108866988 13:54936464-54936486 CAATTCCAACACTGTATACCCGG + Intergenic
1109683091 13:65778656-65778678 CATTTTTAACTGTGTTTACCTGG + Intergenic
1110689246 13:78412733-78412755 CAATTCTGACACTATCTACCTGG + Intergenic
1111438325 13:88242091-88242113 TAATTTTAGGACTATCTACCAGG + Intergenic
1111509379 13:89241560-89241582 CAATTCCAACACTGTCTACCTGG + Intergenic
1111706864 13:91761419-91761441 CAATTCCAACACTATCTACCTGG + Intronic
1111812491 13:93108156-93108178 CAATGTTGATACTATCTACCAGG - Intergenic
1112059059 13:95718903-95718925 CAGTTCTGACACTGTCTATCTGG + Intronic
1112423593 13:99276219-99276241 CAGTTCTGACACTTTCTACCTGG + Intronic
1112592424 13:100776033-100776055 CAATTCCAACACTGTTTACCTGG + Intergenic
1112612828 13:100972871-100972893 CAATTTCATCACTATCTACCTGG + Intergenic
1113577655 13:111405376-111405398 CAATCCTGACACTGGCTACCTGG - Intergenic
1113614827 13:111672713-111672735 CAATTTTTACACTGTCTTATAGG - Intergenic
1115180445 14:30620302-30620324 CAATTTTAAAATTGTCTTCGTGG + Intergenic
1115387311 14:32812985-32813007 CAACTTTGACAGTGTCTATCTGG + Intronic
1115567678 14:34638794-34638816 CAATTATGACACTATCTACTTGG + Intergenic
1115820739 14:37210210-37210232 CAATTCTGACACTGTGTACTTGG + Intronic
1115826949 14:37289321-37289343 AAATTCTGACACTATCTACCTGG + Intronic
1116151935 14:41153218-41153240 CAATTCTGACACCGTCTACCTGG - Intergenic
1116396362 14:44452126-44452148 CAGTTTCAACACTATCTACATGG - Intergenic
1117190845 14:53289560-53289582 CAATTCTGACACTATCTAGCTGG - Intergenic
1117280147 14:54232557-54232579 CAACTTTGCCACTTTCTACCGGG - Intergenic
1117459994 14:55935969-55935991 CAATTTTGAAACTATCTACCTGG + Intergenic
1117969850 14:61240962-61240984 CAATTCTGACACTATGTACCTGG + Intronic
1118020975 14:61713866-61713888 CAATTCTAACACTATCTACCTGG - Intronic
1118597253 14:67445372-67445394 CCATTCTGACACTATCTACCTGG - Intergenic
1118830393 14:69426158-69426180 TAATTCTGACGCTGTCTACCTGG + Intronic
1118955017 14:70473122-70473144 CAATTCTGACACCATCTACCTGG + Intergenic
1119007185 14:70942570-70942592 CAATTCTGACACTGTCTACCTGG + Intronic
1119127070 14:72137397-72137419 CGGTTCTAACACTGTCTACCTGG + Intronic
1119308496 14:73627331-73627353 CAACTCTGACACAGTCTACCTGG + Intergenic
1119340329 14:73871660-73871682 CAACTGTGACACTATCTACCTGG - Intronic
1119551781 14:75519985-75520007 CACTTTCATCACTGTCTAACTGG + Intergenic
1119922554 14:78459858-78459880 AGATTCTGACACTGTCTACCTGG + Intronic
1120073942 14:80134590-80134612 CAATTCTGACCCTATCTACCTGG - Intergenic
1120171971 14:81255150-81255172 CAATTCTGACACTATCTACCTGG - Intergenic
1120180573 14:81338694-81338716 CAATTCTGACACTATCTACCTGG - Intronic
1120371021 14:83636047-83636069 TACTTTTAATACTGTCCACCAGG + Intergenic
1120957484 14:90095765-90095787 CAATTCTGACACTATCTATCTGG + Intronic
1121420941 14:93813570-93813592 TAATTCCAACACTATCTACCTGG - Intergenic
1121459635 14:94064923-94064945 CAATTCAGACACTATCTACCTGG - Intronic
1121519084 14:94573552-94573574 CAATTCCAACACTATCTACCTGG + Intronic
1122215824 14:100203545-100203567 CAATTCTGACACTATCTACCTGG + Intergenic
1122216281 14:100206734-100206756 CAATTCTGACACCATCTACCTGG - Intergenic
1122700268 14:103583664-103583686 CAATTCTGACACTGTCTACTTGG + Intronic
1123027131 14:105431091-105431113 CAATTTTGACACTGCTTACCTGG + Intronic
1123789370 15:23704909-23704931 CAAGTTTTACTCTGTCTCCCAGG - Intergenic
1123797128 15:23783357-23783379 CAAATCTAAGACTGGCTACCAGG - Intergenic
1123854588 15:24395183-24395205 CAATTATAACGCTGCCCACCAGG + Intergenic
1123870616 15:24568370-24568392 AAATTATAACGCTGTCTAACAGG + Intergenic
1124147402 15:27140290-27140312 CAATTATGACACTGTCCACCTGG - Intronic
1124181763 15:27482658-27482680 CATTTGCAACACTGTCTACTTGG + Intronic
1124183724 15:27502544-27502566 CAATTCTAACACTCTCCACCTGG + Intronic
1124207034 15:27730008-27730030 CAATTCCAACACTAACTACCTGG + Intergenic
1124383769 15:29189261-29189283 CAATTCTGACACTCTTTACCTGG - Intronic
1124391511 15:29262865-29262887 CAGTTCCAACACTATCTACCTGG - Intronic
1124434289 15:29634594-29634616 CAGTTCCAATACTGTCTACCTGG + Intergenic
1124649388 15:31463686-31463708 CAACTCCCACACTGTCTACCTGG - Intergenic
1124699237 15:31897003-31897025 TAATTTTAAAACTGTCTTCTGGG - Intergenic
1124818582 15:33020241-33020263 CAATAGTGACACTGTTTACCTGG - Intronic
1125074578 15:35598768-35598790 CAATTCTCACAGTCTCTACCTGG + Intergenic
1125125139 15:36211235-36211257 CAATTCCAACACTATCTACCTGG + Intergenic
1125637409 15:41200751-41200773 CAATTCTGAGACTGTTTACCTGG - Intronic
1126186989 15:45840581-45840603 CAATTCTGACACTATCTACCTGG + Intergenic
1126429980 15:48572845-48572867 CCATATTTAAACTGTCTACCTGG - Intronic
1126697459 15:51338418-51338440 CAGTTCCAACACTATCTACCTGG + Intronic
1127029346 15:54844832-54844854 CAGTTCTAACACTGTCTACCTGG + Intergenic
1127494126 15:59493611-59493633 CAATTCTCACTCTGTCTGCCAGG + Intronic
1127533266 15:59865543-59865565 CATTTCTGGCACTGTCTACCTGG - Intergenic
1127619252 15:60717122-60717144 CAATTCTAACACTGTTTACCTGG - Intronic
1127635706 15:60867386-60867408 CAATTCTGACACTATCTACCTGG - Intronic
1127796328 15:62441626-62441648 CAATTTTTACACCATCTACCTGG + Intronic
1127890397 15:63245584-63245606 CAGTTCTGATACTGTCTACCTGG + Intronic
1127897375 15:63314070-63314092 CAATTCCAACACTGTCTGCCTGG + Intergenic
1128216143 15:65935459-65935481 CAATTCTGACACTATCTATCTGG - Intronic
1128624473 15:69185766-69185788 CAATTCTGGCACTGTCTACCTGG + Intronic
1128825315 15:70710477-70710499 CATTTTTGACACTAGCTACCTGG + Intronic
1128856187 15:71018689-71018711 TAATTCTGACACTGCCTACCTGG + Intronic
1128864537 15:71104424-71104446 CGATTTTGACACTGTCTACCTGG + Intronic
1128958261 15:71972531-71972553 CAAATTTGATACTATCTACCTGG - Intronic
1128958670 15:71976151-71976173 CAGATTTGACACTGTCTACCTGG - Intronic
1129067715 15:72921519-72921541 CAATTTTGACATTATGTACCTGG + Intergenic
1129197291 15:73976413-73976435 CAATTCCAACACTATCTACCTGG - Intergenic
1129339850 15:74878563-74878585 TAATTCCAACACTTTCTACCTGG + Intergenic
1129576969 15:76760131-76760153 CAATTCTGACATTATCTACCTGG + Intronic
1129778732 15:78254805-78254827 CAATTCTGACACTGTCTACCTGG - Intergenic
1130043936 15:80429735-80429757 CAATTATGACACTAACTACCTGG - Intronic
1130074366 15:80675966-80675988 CAATTCTGACATGGTCTACCTGG - Intergenic
1130096439 15:80859655-80859677 CGATTCTGATACTGTCTACCTGG - Intronic
1130210853 15:81920130-81920152 CAATTCCAACACTATCTACCTGG - Intergenic
1131921973 15:97338032-97338054 TAATTCTGACACTGTCTACCTGG + Intergenic
1132166228 15:99594069-99594091 CAATTCTGATACTATCTACCTGG + Intronic
1132366518 15:101261737-101261759 CAATTCTGACACTATCTACCTGG + Intergenic
1135022795 16:18976936-18976958 CAATTCTGACACTATCTACCTGG - Intergenic
1135082894 16:19451679-19451701 CAATTCTGACACTATCTACCTGG + Intronic
1135091152 16:19519001-19519023 CAATTTTGACACTATCTACCTGG + Intronic
1135236519 16:20761464-20761486 TTAGTTCAACACTGTCTACCTGG - Intronic
1135387068 16:22051846-22051868 CAATTCTGACACTGTCTACCTGG - Intronic
1135412531 16:22245979-22246001 CAATTCTGACACCATCTACCTGG + Intronic
1135679678 16:24445751-24445773 CAATTCTGACACTATGTACCAGG - Intergenic
1136354291 16:29733760-29733782 CAATTATAACATCATCTACCTGG + Intergenic
1137281323 16:46979147-46979169 CAATTCTGACACTATCTACTTGG - Intergenic
1137372735 16:47923491-47923513 CAATTCTGATGCTGTCTACCTGG - Intergenic
1137373622 16:47932187-47932209 CAATTCTGACCCTATCTACCTGG + Intergenic
1137982283 16:53080095-53080117 CAATTCTGACACTAACTACCTGG - Intronic
1138206186 16:55126930-55126952 CAATTCTGTCACTGACTACCTGG + Intergenic
1138212533 16:55175395-55175417 CAATTCTGACACTATCTACCTGG + Intergenic
1138296408 16:55889275-55889297 CAGTTCTGACACTATCTACCTGG + Intronic
1138364365 16:56461680-56461702 CAATTCTGACACTATCTACCAGG - Intronic
1138464784 16:57181535-57181557 CAATTCTGACACTACCTACCTGG + Intronic
1138761043 16:59544693-59544715 TTATTTTAACACTGACTCCCTGG - Intergenic
1139000736 16:62506708-62506730 CAATTCTGCCACTATCTACCTGG - Intergenic
1139177988 16:64713189-64713211 CAATTCTCATATTGTCTACCTGG + Intergenic
1139260041 16:65582791-65582813 CAATTTCCACACTGTCTACCTGG - Intergenic
1139276610 16:65733498-65733520 CAATTTAGCCACTGTCTCCCTGG - Intergenic
1139637718 16:68268282-68268304 CAATCCCAACACTATCTACCTGG - Intronic
1140082611 16:71762971-71762993 CAATTCTGACACTGTCTCCCTGG - Intronic
1140530518 16:75661957-75661979 CAATTCCAGCACTGCCTACCTGG + Intronic
1140536691 16:75716255-75716277 CAATTCTGACACTATGTACCTGG + Intronic
1140835359 16:78788857-78788879 CAATCCTGACACTGTCTACGTGG - Intronic
1141078903 16:81033958-81033980 CAATTCCAACACTAACTACCTGG + Intergenic
1142559977 17:804069-804091 CAATGGGAAGACTGTCTACCTGG - Intronic
1143227428 17:5318278-5318300 TAATTCTGACACTATCTACCTGG - Intronic
1143259255 17:5585898-5585920 CAATTCTGACACTGACTGCCTGG + Intronic
1143378750 17:6482684-6482706 CAATTCTGCCTCTGTCTACCTGG - Intronic
1143398080 17:6618502-6618524 CAATTCTGACACTATCTCCCTGG - Intronic
1143540993 17:7568934-7568956 CAATTCCAACACTATCTACCTGG - Intronic
1143653483 17:8278968-8278990 CAATTTGGACACTGTCAAACGGG - Intergenic
1144008979 17:11127415-11127437 CAATTCTGACACTATCTACCTGG + Intergenic
1144151055 17:12446848-12446870 CATTTATGACACTGACTACCTGG - Intergenic
1144263719 17:13547861-13547883 CAATTCTGACACTATCTACCTGG - Intronic
1144335508 17:14265694-14265716 CAGTTCTGACACTATCTACCTGG + Intergenic
1144462985 17:15473084-15473106 CAGTTTCAGCACTGTCTACTTGG - Intronic
1144805022 17:17959291-17959313 CAGTTTTGACACTAACTACCTGG - Intronic
1145086278 17:19943830-19943852 CAGTTCTCACACTGTTTACCTGG - Intronic
1145099795 17:20065245-20065267 CAACTCTGACGCTGTCTACCTGG + Intronic
1145895213 17:28453357-28453379 CAATTCTGACACTATCTGCCTGG + Intergenic
1147468858 17:40637979-40638001 CCATTCTCACACTGTCTACAGGG + Intronic
1147552261 17:41452068-41452090 CTATTTTCACATTGTCCACCTGG + Intergenic
1148937328 17:51173846-51173868 CAATTCTGATACTGTCTACCTGG - Intergenic
1148996931 17:51718735-51718757 CAATTCTGACACTATCTACTTGG - Intronic
1149185521 17:53992714-53992736 TAATTCCAACACTATCTACCTGG + Intergenic
1149268201 17:54950983-54951005 CAATTCCAACACCATCTACCTGG + Intronic
1149977475 17:61280463-61280485 CAAATTAGACACTTTCTACCAGG - Intronic
1150101540 17:62428418-62428440 CAATTCTGACACTGTCTACTTGG + Intronic
1150243766 17:63658088-63658110 CAATGTTAACACTGACAATCTGG - Intronic
1150257372 17:63758363-63758385 CAGTTCTGACACTATCTACCTGG - Intronic
1150883019 17:69052693-69052715 CAATTCTGACACTGTCTACTTGG + Intronic
1151255293 17:72871939-72871961 CAATTCTGCCACTGTGTACCTGG - Intronic
1152051277 17:77980586-77980608 CCATTTCAACATTATCTACCTGG + Intergenic
1153136318 18:1921361-1921383 CAATTTAGACACTGACGACCAGG - Intergenic
1153415147 18:4838225-4838247 CAATTCCAACACTGTCTACCTGG + Intergenic
1153509728 18:5838585-5838607 CAATTCTGACACAATCTACCTGG - Intergenic
1153920698 18:9786567-9786589 CAATTCTGACACTCTCTCCCTGG - Intronic
1153926665 18:9840653-9840675 CAATTCAGACACTGACTACCTGG + Intronic
1154084517 18:11290067-11290089 CAATTCTGACACTAGCTACCTGG + Intergenic
1155171796 18:23272182-23272204 CAGTTCTGACACTATCTACCTGG - Intronic
1155240442 18:23859347-23859369 CACTTCTGACACTCTCTACCTGG + Intronic
1155613933 18:27700251-27700273 CAATTCTGACACTATCTCCCTGG + Intergenic
1155870155 18:31016909-31016931 CCATTTTAACATTGGCTTCCTGG + Intronic
1156314520 18:35955340-35955362 CAATTTTATCAATTTCTACATGG - Intergenic
1157373445 18:47139709-47139731 CAGTTCCAACACTGTCTACCTGG - Intronic
1157698979 18:49747502-49747524 TAATTCTGACACTGTCTGCCTGG - Intergenic
1157739862 18:50082926-50082948 CAATTCTAACACTAACCACCTGG + Intronic
1157807322 18:50667864-50667886 CAATTCCAACACTATTTACCTGG + Intronic
1158509514 18:58078152-58078174 CAATCTCATCACTGCCTACCTGG + Intronic
1158881189 18:61780992-61781014 CAATTCCGACACTGTCTATCTGG - Intergenic
1159017694 18:63115028-63115050 CAGTTCCAACACTGTCTACCTGG - Intergenic
1159303633 18:66611526-66611548 TAATTCTGACACTGTCTACATGG + Intergenic
1160097950 18:75892394-75892416 TAATTTTAAGACTGTCTGGCAGG - Intergenic
1162616050 19:11801010-11801032 AAATTTTCACCCTGTCTCCCAGG - Intronic
1164522514 19:28989938-28989960 CCATTCTGACACCGTCTACCTGG - Intergenic
1164538162 19:29102111-29102133 CAATTCTGACACTGTCTAACTGG - Intergenic
1164612066 19:29639295-29639317 CAATTCTGACACCATCTACCTGG + Intergenic
1165401270 19:35602047-35602069 CAATTCTGACACTATCTACCTGG + Intergenic
1165649892 19:37477094-37477116 CTATTTTGATACTGTCTACCTGG - Intronic
1166632346 19:44418223-44418245 CAATGATGACACTATCTACCTGG + Intronic
1166634599 19:44439089-44439111 CAATTCTGACACTGTCTGCCCGG - Intronic
1166889909 19:45984740-45984762 CAATTATCACACTGTCCAACAGG - Intergenic
1167132131 19:47593847-47593869 CACTTCTGACACTATCTACCTGG - Intergenic
1167206221 19:48104424-48104446 CAATTCTGACGCTGGCTACCTGG - Intronic
1167810431 19:51825002-51825024 AAATTCCAACACTATCTACCTGG + Exonic
1167842641 19:52134589-52134611 TAATTCTGGCACTGTCTACCTGG - Intronic
1167859502 19:52271310-52271332 CAATTTTGATAGTATCTACCTGG - Intronic
1167869438 19:52355543-52355565 CATTTCTAACACTGTCTACCTGG + Intronic
1167880674 19:52454789-52454811 CAATTCTTACACTATCTACAAGG - Intronic
1167957251 19:53075937-53075959 CCATTCTGACACTGTCTATCTGG - Intronic
1167966334 19:53150198-53150220 CAATTCTGACACTGTCTACCTGG - Intronic
1167967101 19:53156849-53156871 CAATTCTGAAACTCTCTACCTGG - Intronic
1168450019 19:56459041-56459063 CAATTCTGACACTGTCTACCTGG - Intronic
1168456096 19:56509602-56509624 CAATTCTGACACTATCTACCTGG - Intronic
1168578139 19:57530635-57530657 CTATTCTAACACTAACTACCTGG - Intronic
925339137 2:3123350-3123372 CAATTTTAAAACTGAGTACCTGG + Intergenic
925939662 2:8804866-8804888 CAATTCTGACACTACCTACCTGG + Intronic
926022998 2:9513530-9513552 CAATTCAAACACTCTCCACCCGG - Intronic
926169132 2:10540032-10540054 CAATTCTGACACTATCTACCTGG - Intergenic
926322982 2:11761953-11761975 CAATTCTGACACCATCTACCTGG + Intronic
926841113 2:17081320-17081342 GAATTTTAACTCAGTCTACGTGG + Intergenic
927031923 2:19129325-19129347 CAGTTTTCTCACTGTCTTCCTGG + Intergenic
927563279 2:24088869-24088891 CAATTCTGACACTCTCTACCTGG - Intronic
927593199 2:24374480-24374502 CAATTCTTACACTGTTTACCTGG - Intergenic
928248479 2:29653088-29653110 CTATTCTGACACTATCTACCTGG - Intronic
928444706 2:31322664-31322686 CAATTCTGACACTAACTACCTGG - Intergenic
928619229 2:33071967-33071989 GAATTCTGACACTGTCTACCTGG + Intronic
929264008 2:39898533-39898555 CAATTCTGATACTATCTACCTGG + Intergenic
929530251 2:42746486-42746508 CAATTCTGACCATGTCTACCTGG + Intronic
929794546 2:45049059-45049081 AAACATTAACACTGTCCACCAGG - Intergenic
930081395 2:47451902-47451924 GGATGTTAACACTGTTTACCTGG - Intronic
930330515 2:49977682-49977704 CACTTTTACCACTGACTTCCAGG - Intronic
930745969 2:54884075-54884097 CTATTCTGACACTGTCTACCTGG + Intronic
931040531 2:58293588-58293610 AAAGTGTAACACTTTCTACCAGG - Intergenic
931439013 2:62274161-62274183 CAATTCTGACATTATCTACCTGG - Intergenic
931829576 2:66036825-66036847 CAATTTTGACACTATCTACCTGG - Intergenic
931958084 2:67450857-67450879 CAATTCTGACACTATCTACTTGG + Intergenic
932045024 2:68339663-68339685 CAATTCTGACACTATCTACCTGG - Intergenic
932723483 2:74157611-74157633 CAATTTTGATAATGTCTATCTGG - Intronic
932838134 2:75056464-75056486 CAATCTTAAACCTGTTTACCCGG + Intronic
932890908 2:75596869-75596891 CAATTTTGACACTAACTGCCTGG - Intergenic
933281859 2:80340760-80340782 CAATTCTGACATTATCTACCTGG + Intronic
933287675 2:80401924-80401946 CAATTCTAACACTATCTACCTGG + Intronic
933553791 2:83807592-83807614 AAATTCTGACACTGTCTACCTGG + Intergenic
933725875 2:85426918-85426940 CAATTCCAACACTACCTACCTGG - Intronic
933790651 2:85881363-85881385 CAACTTTAAAACTGTGTAACAGG + Intronic
934050545 2:88206849-88206871 CAATTCTAACACTATCTACCAGG - Intergenic
934106050 2:88695362-88695384 CAATTTCAACACTCTCTACCTGG - Intronic
934517368 2:94997170-94997192 CAATTCTGATACTGTCTACCCGG - Intergenic
935184321 2:100717955-100717977 CAATTCTAACACCATCTACCTGG + Intergenic
935235934 2:101138421-101138443 CAATTCTGACACTAACTACCTGG + Intronic
935654922 2:105413917-105413939 CAATTCTGACACTATCTACCTGG + Intronic
935985222 2:108666096-108666118 CAATTCCCACACTATCTACCTGG + Intronic
936117525 2:109713953-109713975 CAGTTCTGACACTATCTACCTGG + Intergenic
936137656 2:109909742-109909764 CAATTCCCACACTATCTACCTGG + Intergenic
936207041 2:110461743-110461765 CAATTCCCACACTATCTACCTGG - Intronic
936595174 2:113840591-113840613 CAGTTCCGACACTGTCTACCTGG - Intergenic
936602385 2:113910596-113910618 CAATTCCAATACTATCTACCTGG - Intronic
936859064 2:116994319-116994341 CAATTCTCACGCTATCTACCTGG + Intergenic
937115250 2:119400262-119400284 CAATTCTGGTACTGTCTACCTGG + Intergenic
937631485 2:124106872-124106894 CAATTCTGACAGTATCTACCTGG - Intronic
938417140 2:131113030-131113052 CAACTGTCACACTATCTACCTGG - Intronic
938643844 2:133311056-133311078 CAATTCTGACACGATCTACCTGG + Intronic
938708619 2:133955884-133955906 CAATTCTGACACTACCTACCTGG - Intergenic
938724711 2:134097151-134097173 GAATTTTAACTGTGTCAACCAGG + Intergenic
938884199 2:135626115-135626137 CAATTCTGACACTCTATACCTGG - Intronic
939060995 2:137421260-137421282 CAATTCTAATACTGTCTATCTGG + Intronic
939162980 2:138610890-138610912 CAATTCTGACACTACCTACCTGG - Intergenic
940190806 2:151038086-151038108 CAATTCTGACACTGTCTACCTGG - Intronic
940588845 2:155693691-155693713 CATTTTTACCACTGTATCCCAGG + Intergenic
940692349 2:156934645-156934667 CAATTTTGACACTAACTACCAGG - Intergenic
941055540 2:160783803-160783825 TAATATTAGCACTGTCTCCCAGG - Intergenic
941310663 2:163926621-163926643 CAATTCTGATACTGTCTACCTGG - Intergenic
941881048 2:170480692-170480714 CAATTTGGACATTGTCCACCTGG - Intronic
942224341 2:173802255-173802277 CAATTTTGACACTATCCACCTGG + Intergenic
942622203 2:177857767-177857789 CCAATTTTACACTGTCTACAAGG + Intronic
942745304 2:179225110-179225132 CAGTTCTAACACTGCCTACCTGG - Intronic
942857539 2:180567635-180567657 CAATTCTAACACTATCTCCTGGG - Intergenic
942867743 2:180696854-180696876 CATTTTCTACACTTTCTACCTGG - Intergenic
943311749 2:186334142-186334164 CAATTCTGACACTATCTAGCTGG - Intergenic
943468541 2:188262389-188262411 CAATTCTGACACTATCTACCTGG - Intergenic
943676663 2:190722176-190722198 CAATTCTGACACTCTCTACCTGG - Intergenic
944278038 2:197861676-197861698 CAATTGTGACACTCTCTACCTGG - Intronic
944504191 2:200392778-200392800 TAATTCTGACACTGTCTACCTGG - Intronic
944533712 2:200689413-200689435 CAATTCTGACCCTATCTACCAGG + Intergenic
944535618 2:200706980-200707002 CAATTCTGACACTCCCTACCTGG + Intergenic
944992661 2:205255468-205255490 CAATTCTGACACTATCTACCTGG + Intronic
945430140 2:209754485-209754507 CAATTCTGACACTATCTTCCTGG - Intergenic
945517631 2:210782772-210782794 CAATTCCAACACTATCTATCTGG + Intergenic
945672388 2:212817700-212817722 CAATTTTAAAACTGTTTAAATGG + Intergenic
946497893 2:220214352-220214374 CAATTCTGACACTATTTACCTGG - Intergenic
946743720 2:222825842-222825864 CCATTCTGACACTATCTACCAGG + Intergenic
947294755 2:228618066-228618088 CAATTCTGACACTGTATACCTGG - Intergenic
947537706 2:230951231-230951253 CAATTCCAACACTGTCTACCTGG - Intronic
947658761 2:231850774-231850796 CAATTTTGACACTAACTACCTGG - Intergenic
947964416 2:234267487-234267509 CAATTCTGACACTATCTGCCTGG - Intergenic
948065709 2:235077411-235077433 AAATTCTAACACTCTCTACTGGG + Intergenic
948389692 2:237603021-237603043 CAATTCTAACACTGTCCACCTGG - Intergenic
1169031421 20:2410667-2410689 CAATTCTAACAGTAGCTACCTGG - Intronic
1169319338 20:4618476-4618498 CAATTCTGACACTTTCTACTTGG + Intergenic
1169415078 20:5409210-5409232 CAATTCTGACACTATCTACCTGG + Intergenic
1170016536 20:11787986-11788008 CAATTCTGACGCTATCTACCTGG - Intergenic
1170123658 20:12938146-12938168 CAATTCTGACACTGTCTACCTGG + Intergenic
1170254325 20:14323124-14323146 TAATCCCAACACTGTCTACCTGG + Exonic
1170581679 20:17704092-17704114 CATTTTTATCACCTTCTACCGGG + Intronic
1171403977 20:24897483-24897505 CATTTCCAACCCTGTCTACCTGG + Intergenic
1171870007 20:30517161-30517183 CAATGATGACACTATCTACCGGG - Intergenic
1172354830 20:34272405-34272427 CAATTCCAACACTATCTACTTGG + Intergenic
1172411058 20:34723256-34723278 CAATTCTGACACTATCTGCCTGG - Intronic
1173061413 20:39665156-39665178 CAATTTGGGCACTGTCTACCTGG - Intergenic
1174687168 20:52467146-52467168 CAATTCTGACACTATCTACCTGG + Intergenic
1174934381 20:54851820-54851842 CAATTCTGATACTATCTACCTGG + Intergenic
1175096467 20:56545132-56545154 CAATTCTGACACTACCTACCTGG - Intergenic
1175449015 20:59046547-59046569 CAATTCCAACACCATCTACCTGG - Intergenic
1175640623 20:60626909-60626931 CAATTACGACACCGTCTACCCGG + Intergenic
1177029725 21:15967591-15967613 CAATTCTGACACTATCTACCTGG - Intergenic
1177296008 21:19176779-19176801 CAAATATAACACTGTCAGCCAGG + Intergenic
1177557743 21:22714323-22714345 CAATTCCAACACTGTCTACCTGG - Intergenic
1178386433 21:32154599-32154621 CAATTTAAACACTGAGGACCAGG - Intergenic
1178421124 21:32444236-32444258 CAATTCTGACACCATCTACCTGG + Intronic
1178529421 21:33362790-33362812 TAATTCTGACACTGTCTACCTGG - Intergenic
1178775189 21:35543165-35543187 CAATTCTGACACTAACTACCTGG - Intronic
1179274622 21:39880850-39880872 CAATTTAAACATTGTTTTCCAGG - Intronic
1179607360 21:42525405-42525427 CAATTCTCACACTGTCTTCCAGG - Intronic
1180889684 22:19277794-19277816 CAATTCTGACAATATCTACCTGG + Intronic
1181489527 22:23252897-23252919 CAGTTTTGACATTGTCTACCTGG + Intronic
1181692158 22:24569571-24569593 CAGTTCTGACACTATCTACCTGG + Intronic
1182052871 22:27326372-27326394 GAATTCTGACACTGTCTACCTGG - Intergenic
1182807268 22:33083929-33083951 CAATCTTAGCACAATCTACCAGG + Intergenic
1184125046 22:42481052-42481074 CAGTCCCAACACTGTCTACCTGG - Intergenic
1184133261 22:42530513-42530535 CAGTCCCAACACTGTCTACCTGG - Intergenic
1184429756 22:44435127-44435149 CAATTCTAGCATTATCTACCTGG - Intergenic
1184575218 22:45358430-45358452 CAATTCTGACACTGTCTACCTGG - Intronic
1184952298 22:47852215-47852237 CAAATGTAATAATGTCTACCAGG - Intergenic
950893050 3:16422245-16422267 CAATTTCAACAGAGTTTACCAGG + Intronic
951487612 3:23231591-23231613 CAATTCTGACACTCTCTACCTGG + Intronic
951715007 3:25633095-25633117 CAATTTTGATACTAACTACCTGG + Intronic
952490669 3:33869383-33869405 CAATTATAACACTACCTAGCAGG - Exonic
952535905 3:34308853-34308875 CAATTTTGACACTAACTAGCTGG + Intergenic
952773565 3:37023299-37023321 TAATTCCAACACTGTCTACTTGG + Intronic
953082958 3:39638295-39638317 CAATTCTTACACTATCTACCTGG + Intergenic
953222072 3:40980582-40980604 CAATTCCGACACTATCTACCTGG - Intergenic
953797571 3:45997179-45997201 CAATTCCGACACTATCTACCTGG + Intergenic
954565832 3:51599082-51599104 CAATTCTAACACTATCTACCTGG - Intronic
954706830 3:52485446-52485468 AAATTTGTAGACTGTCTACCTGG + Intronic
954977989 3:54715036-54715058 CAGTTCTGACACTATCTACCTGG + Intronic
955320184 3:57968730-57968752 CAATTCTGACACCATCTACCTGG - Intergenic
955378136 3:58415230-58415252 CAATTCTGACACTATCTACCTGG + Intronic
956212304 3:66814495-66814517 CAATTCTGACACTATCTACCTGG + Intergenic
956381143 3:68665695-68665717 ATATTCTGACACTGTCTACCTGG + Intergenic
956708103 3:72016708-72016730 CATTTCTGACACTATCTACCTGG - Intergenic
956905649 3:73762522-73762544 CAATTCTGACACTATCTACTTGG + Intergenic
957050271 3:75406302-75406324 CAATTCTGACACCATCTACCTGG - Intergenic
957303081 3:78419356-78419378 CCATTTTGACACTATCTACCTGG + Intergenic
957670993 3:83302769-83302791 TAATTCCAACACTATCTACCTGG + Intergenic
958095867 3:88943230-88943252 CAATTCTGACACTATCTACCTGG - Intergenic
959228427 3:103616407-103616429 CAATTCTGACACTATCTACCTGG - Intergenic
960240194 3:115331650-115331672 TAATTTTGACACTATCTACCTGG - Intergenic
960829536 3:121831609-121831631 CAATTCTGACACTGTCTACTTGG - Intronic
960982920 3:123248904-123248926 CACTTTTAACACTATCTGCCTGG + Intronic
961072282 3:123944097-123944119 CAATTCCAACACTATCTACCTGG - Intronic
961100026 3:124190840-124190862 CAATTCTGACATTATCTACCTGG + Intronic
961173142 3:124813382-124813404 CAATTCTGACACTATCTACCTGG + Intronic
961237981 3:125384994-125385016 CAATTCTGACACAATCTACCTGG + Intergenic
961585281 3:127917119-127917141 CAATTCTGACACCATCTACCTGG + Intronic
961841708 3:129719598-129719620 CAATTCTGACTCTGTCTACCTGG - Intronic
961855794 3:129869566-129869588 CAATTCTGACACTGTCTACCTGG - Intronic
961882581 3:130072740-130072762 CAATTCTGACACCATCTACCTGG - Intergenic
962194801 3:133352420-133352442 CAATTTTTATACTGTCTACCTGG + Intronic
962447155 3:135476554-135476576 CAATTCTGACACTATCTACCTGG - Intergenic
962712621 3:138100611-138100633 CAATTCTGACACTATCTACCTGG - Intronic
963538307 3:146555939-146555961 CAATTCTTACACTGTCCACCTGG + Intergenic
963714903 3:148791785-148791807 CAGCTTTAACACTGTTTTCCTGG + Intronic
963756553 3:149240236-149240258 CAATTTTGACACTATCTACCTGG - Intergenic
964065214 3:152569833-152569855 TAATTTCAACAGTGTCTCCCTGG + Intergenic
964240390 3:154585921-154585943 CAACTCTGACACTGTCTACCTGG - Intergenic
964519939 3:157554166-157554188 CAATTCTGACACTGTCTACCTGG - Intronic
964540219 3:157771530-157771552 CAATTTTAACAGTGTCTCCAAGG + Intergenic
964800790 3:160555090-160555112 TAATTCTGACACTGTCTACCTGG - Intronic
964914026 3:161817713-161817735 CAATTCTGACACCATCTACCTGG + Intergenic
965346342 3:167555610-167555632 CTATTCTGACACTGTCTACTTGG - Intronic
965843669 3:172937049-172937071 CAATTCTGACACTAACTACCTGG - Intronic
965867612 3:173224809-173224831 CAATTCTAACACTATCTGCCTGG + Intergenic
966664442 3:182454933-182454955 CAATTTTGAAACTATCTACCTGG - Intergenic
966694822 3:182778826-182778848 CAATTCTGACACTATTTACCTGG + Intergenic
967195503 3:187022187-187022209 CAGTTCCAACACTATCTACCTGG - Intronic
967469914 3:189849409-189849431 CAACTGTGACACTGTCTACCCGG - Intronic
967594703 3:191315477-191315499 CAATTCCGACACTATCTACCTGG - Intronic
967979197 3:195055366-195055388 CAATTTTATCACCCCCTACCTGG + Intergenic
968790837 4:2660221-2660243 AACTTTTAACACTGTTTATCTGG + Intronic
969128339 4:4971427-4971449 CAATTCTGACATAGTCTACCTGG + Intergenic
970420035 4:15897523-15897545 CAATTTTGACATTAACTACCTGG + Intergenic
970628905 4:17920189-17920211 CAATTCTGATACTATCTACCTGG - Intronic
970994135 4:22246315-22246337 CAATTCTGACACTATTTACCTGG - Intergenic
971363344 4:25956427-25956449 CAATTCTGACACTATCTACCTGG - Intergenic
971514515 4:27469457-27469479 CAATTCTGACATTATCTACCTGG - Intergenic
971640538 4:29126435-29126457 CAATTCTGACACTATCTACTCGG - Intergenic
971806004 4:31358147-31358169 CAATTCTGACACCATCTACCTGG - Intergenic
971915583 4:32866421-32866443 TAATTCTAACACTGTCTACCTGG - Intergenic
971933934 4:33122448-33122470 CAATTTTCTCTCTGTCTTCCAGG - Intergenic
972403523 4:38726253-38726275 CAAATTTAGCACTGTCCACCTGG - Intergenic
972905921 4:43747089-43747111 TAATTTTGACACTGTCTGCCTGG + Intergenic
973078057 4:45955545-45955567 CAATTCCAACACTATCTATCTGG + Intergenic
973229976 4:47829633-47829655 CAATTCTGACACTATCTACCTGG - Intronic
973539100 4:51917805-51917827 CAATTTTAACAGCGTGCACCTGG - Intergenic
973755396 4:54068752-54068774 CAATTCCAGCACTCTCTACCTGG + Intronic
973919466 4:55670306-55670328 CAATTTTAACACTATCTACCTGG + Intergenic
974450977 4:62058833-62058855 TAATTCTAATACTGTCTTCCAGG - Intronic
974454421 4:62108304-62108326 CAATTTTAAAACTTTCTACAAGG + Intergenic
976044620 4:80930532-80930554 TAATTCTGACACTATCTACCTGG - Intronic
976190608 4:82482981-82483003 CAATTGTGACACTAACTACCCGG - Intergenic
976282724 4:83341201-83341223 CAGTTCTGACACTATCTACCCGG + Intergenic
976296574 4:83478616-83478638 CAATGTTAACACTTTCTCTCAGG - Intronic
976305546 4:83555822-83555844 AAATTTTGACACTATCTACCTGG - Intronic
976657783 4:87507689-87507711 GAATTCTGACACTGTGTACCTGG + Intronic
977235690 4:94505164-94505186 CAATTCTGACACTACCTACCTGG + Intronic
977357511 4:95966239-95966261 CAATTCTGACAGTATCTACCTGG + Intergenic
977401771 4:96541561-96541583 CAATTCTGACACTATCTACCTGG - Intergenic
977476183 4:97512927-97512949 CAATTCTGACACTATCTACCTGG + Intronic
977718410 4:100209755-100209777 CAATTCCTACACTATCTACCTGG - Intergenic
978220736 4:106271277-106271299 CAATTTTTACACAGTATTCCTGG - Intronic
978232077 4:106411984-106412006 CAATTCTGACACTATATACCTGG + Intergenic
978574225 4:110172200-110172222 CAATTTTGACACTATCTGCTTGG - Intronic
978723383 4:111941376-111941398 CAGTTCTGACACTATCTACCTGG - Intergenic
978846969 4:113285297-113285319 CAGTTCTAACACTGTCTATCTGG + Intronic
980636632 4:135514103-135514125 TAATTTCAACACTGTCCAGCTGG - Intergenic
980922812 4:139103693-139103715 CAGTTCTGACACTGTCTACTTGG - Intronic
981742418 4:148016672-148016694 CAGTTCCAACACCGTCTACCTGG + Intronic
981822557 4:148902744-148902766 CAATTTTCACATTGTCTCCCAGG - Intergenic
981847305 4:149184317-149184339 CACTTCTAACACTATCTACCTGG - Intergenic
981907856 4:149943147-149943169 CAATTCTGACACTGTCTGCCTGG - Intergenic
982360719 4:154516067-154516089 CAATTCTGACACCATCTACCAGG - Intergenic
982522768 4:156440097-156440119 CACTTTTCACACTTTTTACCTGG - Intergenic
982798682 4:159674686-159674708 CAGTTCTGACACTATCTACCTGG - Intergenic
982865559 4:160505891-160505913 TAATTCTGACACTATCTACCCGG - Intergenic
983052911 4:163069568-163069590 CAATTCTGATACTATCTACCTGG - Intergenic
983768589 4:171519227-171519249 CAACTCTGACACTATCTACCTGG + Intergenic
983829355 4:172305225-172305247 TAATTTTCTCATTGTCTACCTGG - Intronic
984232512 4:177115748-177115770 CAATTCTGACACTGTCTACCTGG - Intergenic
984905441 4:184621632-184621654 CAATTCTAACACTATCTACCTGG - Intergenic
986147182 5:5089301-5089323 CAATTCTGACACTATCTATCTGG - Intergenic
987336814 5:16904517-16904539 CAGTTCTGACACTGTCTACCCGG - Intronic
987719579 5:21616684-21616706 CAATTCGGACACTGTCTACCTGG - Intergenic
988280796 5:29143925-29143947 CAATTCTGACACTGCCAACCTGG - Intergenic
988494547 5:31733908-31733930 CAATTCTGACACTGTCTACCTGG + Intronic
989309696 5:40000168-40000190 CAGTTCTGACACTGTCCACCTGG - Intergenic
989512879 5:42309033-42309055 CAATTCTGACACTATCTATCTGG + Intergenic
989739541 5:44753932-44753954 CAATTCTGACAGTATCTACCTGG - Intergenic
990081182 5:51915515-51915537 CAATTCTGATGCTGTCTACCAGG - Intergenic
990139828 5:52690329-52690351 CAATTTCAAAACTGCCTCCCAGG + Intergenic
990306011 5:54494481-54494503 CAGTTCTGACATTGTCTACCTGG - Intergenic
990604506 5:57395384-57395406 CAAATCTGACACTGTCTACTGGG + Intergenic
990775393 5:59300727-59300749 CAGTTCCAACGCTGTCTACCTGG + Intronic
990856406 5:60272158-60272180 TAATTTTAATGCTGTCTCCCAGG - Intronic
990866670 5:60387819-60387841 CAATTCTGCCACTATCTACCTGG + Intronic
991697750 5:69288806-69288828 CAATTCTCACACTGTCTACCTGG - Intronic
991995242 5:72379963-72379985 CAGTTCTGACACTGTCTACCCGG - Intergenic
992212281 5:74492733-74492755 CAATTCTGACACTGTCTACCTGG + Intergenic
992295270 5:75321330-75321352 CAATTCTAATACTATTTACCTGG + Intergenic
992395951 5:76369860-76369882 CAATTCTGACACTGTCTACCTGG + Intergenic
993189880 5:84668599-84668621 CAATTCCAACACTATCTACCTGG - Intergenic
993383283 5:87232742-87232764 CAATCCTAACACTGTGTACCTGG - Intergenic
993715201 5:91269280-91269302 CAATTCTGACACTATCTACCTGG - Intergenic
993718139 5:91295566-91295588 CAATTAGGACACTGTCTACTTGG - Intergenic
993810499 5:92470438-92470460 CAATTCCAACACAATCTACCTGG + Intergenic
994110735 5:96000949-96000971 CATTTTTAATAAGGTCTACCTGG - Intergenic
994227028 5:97264901-97264923 CAATTCCAACACCATCTACCTGG + Intergenic
994369013 5:98947984-98948006 CAATTCTGACACTATCTACCTGG - Intergenic
994596886 5:101849959-101849981 TAATTTAAACACATTCTACCAGG - Intergenic
995379662 5:111517959-111517981 CAATTTGGACACTATCTACCTGG - Intergenic
995599540 5:113780501-113780523 CAATTCTGACACTATCTCCCTGG - Intergenic
996078433 5:119226610-119226632 TAATTATGACACAGTCTACCTGG + Intronic
996216667 5:120876102-120876124 AGATTTTAACACTGTCTCCCAGG + Intergenic
996568834 5:124910385-124910407 CAATTCTGACACTATCTAACTGG - Intergenic
996623290 5:125537521-125537543 CAGTTCTGACACTGTCTATCTGG + Intergenic
996707705 5:126513766-126513788 CAATTCCAACACTGTCTACTCGG - Intergenic
997080053 5:130727159-130727181 CAATTTCAACAGTCTCTACCTGG - Intergenic
997428941 5:133824163-133824185 CAGTTCTGACACTGTCTACCTGG + Intergenic
997650956 5:135520241-135520263 CGATTCTGACACTGTCTACCTGG + Intergenic
997838025 5:137212155-137212177 TAATTCTGTCACTGTCTACCTGG - Intronic
998093987 5:139387024-139387046 CAATTCTGGCACTATCTACCTGG - Intergenic
998211721 5:140204588-140204610 CCACTTTACCTCTGTCTACCAGG - Intronic
998329263 5:141309468-141309490 CAATTCCAACACTATCTACCTGG + Intergenic
998605680 5:143632427-143632449 CAGTTCTAACACTATCTATCTGG + Intergenic
998646643 5:144069363-144069385 CAATTCTAACACTATCTACTTGG - Intergenic
998777936 5:145623853-145623875 CAATTCTGACACTGTCTGCCAGG + Intronic
999392744 5:151206026-151206048 CAATTCTGACACTATCTACCTGG + Intronic
999432427 5:151535793-151535815 CAATTCCAACACTATCTACCTGG - Intronic
999489125 5:152031701-152031723 CAATTTTAACAGTGTCTCAGTGG + Intergenic
999712181 5:154328593-154328615 CAATTCTGACACTACCTACCTGG + Intronic
999990786 5:157047925-157047947 CAGTTCTTACACTGTCTACCCGG - Intronic
1000416434 5:160988579-160988601 CAATTCTGACACTATCCACCTGG - Intergenic
1000580660 5:163031813-163031835 CAATTCTGACACTATCTACCTGG - Intergenic
1000813569 5:165891791-165891813 CAATTCTGACACTGATTACCTGG - Intergenic
1000867519 5:166533422-166533444 TAATTTTAAAAATGTCTTCCAGG - Intergenic
1000984213 5:167849535-167849557 CAATTCTGACACTATCTACCTGG + Intronic
1001489730 5:172146892-172146914 CAATTCCGACACTATCTACCGGG + Intronic
1001582698 5:172809709-172809731 CAATTTCAACACTATCTACCTGG - Intergenic
1001703479 5:173724222-173724244 CAATTCTGACAGTATCTACCTGG + Intergenic
1001945013 5:175771597-175771619 CATTTCTAACACTAACTACCTGG + Intergenic
1002124245 5:177029942-177029964 CAATTCTGACACTATCTACCTGG - Intronic
1002356245 5:178631501-178631523 CAATGATAACACAGTCAACCAGG - Intergenic
1002544090 5:179926859-179926881 CAGTTCCAACGCTGTCTACCTGG - Intronic
1002557871 5:180057980-180058002 CAATTCTGACACTAACTACCTGG - Intronic
1002626405 5:180532630-180532652 CAATTCCAACACTGTCTTCCTGG + Intronic
1002659791 5:180783861-180783883 CAGTTCCAACCCTGTCTACCTGG - Intergenic
1002857369 6:1050301-1050323 CAATTATAACACTCTCCACCTGG + Intergenic
1002886886 6:1305300-1305322 AAATTTTAACACTACCTACATGG + Intergenic
1003238321 6:4318421-4318443 CAATTCTGACACCATCTACCTGG - Intergenic
1003324475 6:5082268-5082290 CAATTCTGACATTATCTACCTGG - Intergenic
1003391418 6:5716567-5716589 CAGTTCTGACACTGTCTACCTGG + Intronic
1003507795 6:6753769-6753791 CAATTCTGACACCATCTACCTGG - Intergenic
1003610866 6:7614052-7614074 CATTTCTGACATTGTCTACCTGG + Intergenic
1003799293 6:9644427-9644449 CAATCTTAACATTGTCTTCCTGG - Intronic
1004278189 6:14256640-14256662 CAATTCCAACACTCCCTACCTGG + Intergenic
1004394401 6:15235505-15235527 CAATTCCAACACTATCCACCTGG + Intergenic
1004590956 6:17051037-17051059 CAATTCCGACACTGTCTGCCTGG - Intergenic
1005152905 6:22772926-22772948 CAATTCCAACACCGTCTACCGGG - Intergenic
1005222483 6:23602433-23602455 CAATTCCGGCACTGTCTACCTGG - Intergenic
1005310478 6:24554126-24554148 CACTTTTGCCGCTGTCTACCTGG - Intronic
1005680490 6:28202811-28202833 CAATTCTGACACTATCTACCTGG + Intergenic
1005879565 6:30045507-30045529 CAATGTCAACACTGTCTACCTGG + Intergenic
1005924304 6:30429480-30429502 CAATTCTGACACTATCTCCCTGG + Intergenic
1006041896 6:31263061-31263083 CAATTCTGACACTAACTACCTGG - Intergenic
1006051550 6:31348953-31348975 CAATTCTGACACTAACTACCTGG - Intronic
1006369832 6:33637142-33637164 CAATTCTGACACTATCTGCCTGG + Intronic
1006497790 6:34436426-34436448 CAATTCCCACACTATCTACCTGG + Intergenic
1006962632 6:37949473-37949495 CAATTCTGACACTATCTACCTGG + Intronic
1007134347 6:39507225-39507247 CAATTCTGACACTGTCTACCTGG - Intronic
1007535844 6:42588019-42588041 CAACTCTGACCCTGTCTACCAGG + Intronic
1007674795 6:43584612-43584634 CAATTCCAACACTGTCTACCTGG + Intronic
1007801355 6:44396605-44396627 TAACTCTAATACTGTCTACCTGG + Intronic
1007811960 6:44492674-44492696 CATTTTTGACACCATCTACCTGG - Intergenic
1008095487 6:47335453-47335475 CAATAATGACACTATCTACCTGG - Intergenic
1008119347 6:47593062-47593084 CAATTCTGACACTGTCTTTCTGG - Intronic
1008352536 6:50509425-50509447 CAATATTGACACTTTCTAACAGG + Intergenic
1008357119 6:50568110-50568132 CAATTCTGACACTATCTACCTGG + Intergenic
1008656510 6:53619441-53619463 CAATTCTGACACTATCTATCTGG + Intergenic
1008897719 6:56576492-56576514 CAATTCTGACACTGTCTACCTGG - Intronic
1009462621 6:63932803-63932825 CAATTCTGACACTATTTACCTGG + Intronic
1009927233 6:70134867-70134889 CAATTCTGACACTATTTACCTGG + Intronic
1010023905 6:71193644-71193666 CAATTCTGACACAGTCTACCTGG - Intergenic
1010238087 6:73591665-73591687 CAGTACTGACACTGTCTACCTGG + Intergenic
1010426482 6:75733892-75733914 CAATTCTGACACTGTCTACCTGG - Intergenic
1010588739 6:77687476-77687498 CAATTCTGACACTAACTACCTGG + Intergenic
1010765281 6:79771836-79771858 CAATTCCGACACTATCTACCTGG + Intergenic
1011047242 6:83098397-83098419 CAATTTGGACACTATCTACCTGG + Intronic
1011337239 6:86275023-86275045 CAATTTTCACACTGTCTATCTGG - Intergenic
1011381113 6:86743186-86743208 CAATTCTGACACTGTCTACCTGG + Intergenic
1011415525 6:87115939-87115961 CAATTCTGACACTATCTATCTGG - Intergenic
1011544720 6:88470539-88470561 CAATTTTGATACTATCTACCTGG - Intergenic
1013071916 6:106737293-106737315 TAATTCTGACACTGTCTACCTGG + Intergenic
1013438859 6:110140566-110140588 CAATTCTGACACTATCTACCTGG - Intronic
1013510477 6:110840278-110840300 CAATTCCGACACTGTCTACCTGG + Intronic
1014107568 6:117584273-117584295 CAATTTTGACACTATCTACCTGG + Intronic
1014554439 6:122829085-122829107 AAATGTTGACACTGTCTACCTGG + Intergenic
1015187389 6:130433575-130433597 CAATTTTAGGACTTTCTTCCTGG - Intronic
1015199188 6:130560060-130560082 CAATTATCACAGTGACTACCAGG + Intergenic
1015593422 6:134843719-134843741 CAATTCCAACACTATCTACCTGG - Intergenic
1015976659 6:138797790-138797812 CAGTTCTGACACTGTGTACCTGG + Intronic
1016207756 6:141490597-141490619 CAATTCCCACACTCTCTACCTGG + Intergenic
1017123906 6:151048929-151048951 CAATCCTGACACTGTCTACCTGG + Intronic
1017801091 6:157897187-157897209 CAGTCATGACACTGTCTACCTGG + Intronic
1018011967 6:159678805-159678827 CAATTCTGACACTGTCTACCTGG - Exonic
1018702521 6:166438184-166438206 AAATTTTAACTTTTTCTACCAGG - Intronic
1019635287 7:2072179-2072201 CTGTTCTGACACTGTCTACCTGG - Intronic
1019682583 7:2359776-2359798 CAATTCAGACACTATCTACCAGG - Intronic
1020334635 7:7053186-7053208 CAGTTCCAACACTATCTACCTGG - Intergenic
1021991552 7:26146206-26146228 CAATTCTGACACTATCTGCCTGG - Intergenic
1023117597 7:36877361-36877383 TATTGTTAACACTGTCAACCTGG + Intronic
1023375716 7:39553013-39553035 CAATTCTGACACTATCTACCTGG - Intergenic
1024042030 7:45563387-45563409 CAATTCTGACACTATCTAGCTGG - Intergenic
1024340177 7:48249893-48249915 CAATTCTCGCACTGTCTGCCTGG + Intronic
1024445311 7:49470772-49470794 TAATTCTGACACTATCTACCTGG - Intergenic
1024851778 7:53726108-53726130 CAATTCTGACACTGTCTCTCAGG - Intergenic
1024901995 7:54330086-54330108 CAATTCTGACTCTATCTACCTGG + Intergenic
1026107621 7:67433491-67433513 CAATTCTGACACTCACTACCTGG + Intergenic
1026836334 7:73641933-73641955 CAATTCTGACACTATTTACCTGG + Intergenic
1027785874 7:82577939-82577961 CAATTCTGACATTATCTACCTGG - Intergenic
1029036623 7:97529267-97529289 CAATTCTCACCCTGTCTAACTGG + Intergenic
1030780867 7:113598140-113598162 CAATTCCAATACTGTCTACCTGG - Intergenic
1031479188 7:122257662-122257684 CAATTGCAACATCGTCTACCTGG - Intergenic
1031694078 7:124827451-124827473 CAATTCTGACACTATCTACCTGG - Intronic
1031928931 7:127664779-127664801 CAATTCAGACACTGTCTTCCTGG - Intronic
1032030689 7:128481277-128481299 CAATTCTGACACTGTCTACTTGG + Intronic
1032913700 7:136462869-136462891 CAACTCTGACACTATCTACCCGG - Intergenic
1033082961 7:138315056-138315078 CAATTCTGACACTCTCTACCTGG + Intergenic
1033458693 7:141525618-141525640 CAATTCTGATACTGCCTACCTGG - Intergenic
1033661584 7:143406661-143406683 CAGTTCTTACACTATCTACCTGG - Intronic
1033738082 7:144244460-144244482 CAATTCTGACACTATCTACTGGG - Intergenic
1033744973 7:144306497-144306519 CAATTCTGACACTATCTACTGGG + Intergenic
1033905939 7:146203198-146203220 CAATTCTAACACTATCCATCTGG + Intronic
1034561162 7:151880035-151880057 CATTTCTGACACTGTCTACCTGG - Intergenic
1035442378 7:158912352-158912374 CAATCTTAACATTGTCTAGTTGG + Intronic
1036419016 8:8578722-8578744 CAAGTTTTACTCTGTCTCCCAGG + Intergenic
1037264777 8:17046245-17046267 CAATTCTGACACTGTGTACCTGG - Intronic
1037442028 8:18926798-18926820 CATTTCCAACACTATCTACCCGG + Intronic
1037558832 8:20054272-20054294 CAATTCTGACATTGTCTACCTGG + Intergenic
1038298829 8:26323381-26323403 CAGTTCCAACACTGTCTACCTGG + Intronic
1038405621 8:27320345-27320367 CAATTCAGACACTATCTACCTGG + Intronic
1038896292 8:31786464-31786486 CTACTCTGACACTGTCTACCTGG + Intronic
1039229761 8:35430612-35430634 CAATTCCAACACTATCTACCTGG - Intronic
1040424613 8:47273103-47273125 CAATTTTGATGCTCTCTACCTGG + Intronic
1040946219 8:52887139-52887161 CAAGTTTAACACTATCTACCTGG - Intergenic
1040969025 8:53113925-53113947 CAGTTCTGACACAGTCTACCTGG - Intergenic
1041799128 8:61779660-61779682 CAATTCTGACACTATCTACCTGG + Intergenic
1042036889 8:64542655-64542677 CAATTCTGACACTATCTACTTGG - Intergenic
1042149660 8:65768027-65768049 CAGTTCCAACACTGTCTACCTGG - Intronic
1043528266 8:81120232-81120254 CAATTCTGACACTAACTACCCGG - Intergenic
1044062760 8:87659954-87659976 CAATTTTAAAATTGGTTACCTGG + Intergenic
1044581529 8:93830528-93830550 CAATTCTGACACTATCTATCTGG - Intergenic
1044945590 8:97385920-97385942 CAATTCTGATACTATCTACCTGG - Intergenic
1045097105 8:98809346-98809368 CAATTTTGATACTATCTCCCTGG - Intronic
1045347762 8:101310118-101310140 CAATTCTGACACTATGTACCTGG + Intergenic
1045473297 8:102532075-102532097 CAATTCTGACACCATCTACCTGG + Intronic
1045608632 8:103808643-103808665 AAATTTTAAGACTGTCTACTTGG + Intronic
1045991599 8:108314803-108314825 CAATTCTGACACTGTTTACCTGG - Intronic
1046017924 8:108628397-108628419 CAATTTTGATACTATCTACCTGG + Intronic
1046121642 8:109855185-109855207 CAATTATGACACTTCCTACCTGG + Intergenic
1046219241 8:111192311-111192333 CAATTCTGACACAGTCTACCTGG + Intergenic
1046362734 8:113183939-113183961 CAATTCTGACATTGTCTACCTGG + Intronic
1046537052 8:115528670-115528692 TAATCTGAACACTGTCTACTGGG - Intronic
1047399583 8:124534690-124534712 CAATTCTCACACTATCTACCTGG + Intronic
1047968446 8:130064666-130064688 CAATTCTGACACCATCTACCTGG + Intronic
1048191453 8:132293374-132293396 CAATTCTGACACCATCTACCTGG - Intronic
1048413640 8:134202159-134202181 CAACTCTAACACTAACTACCTGG - Intergenic
1049821382 8:144635748-144635770 CAGTCCTCACACTGTCTACCTGG - Intergenic
1049966426 9:784418-784440 CAACTCCAACACTCTCTACCTGG + Intergenic
1050313868 9:4381342-4381364 AAATTTTTTCACTGTCTGCCTGG + Intergenic
1050376433 9:4978690-4978712 CAAATTTAACACTGTGTAACTGG + Intergenic
1050434379 9:5593407-5593429 CACTTCTGACCCTGTCTACCTGG - Intergenic
1050460677 9:5874933-5874955 CAACTCCAACACTATCTACCTGG - Intergenic
1050988368 9:12112941-12112963 CAATTCTGACACTAACTACCTGG + Intergenic
1052414337 9:28158001-28158023 CAACTTTCACACTGGGTACCAGG - Intronic
1052508957 9:29390127-29390149 CAATTCTGACACTACCTACCTGG + Intergenic
1052614886 9:30825602-30825624 TAATTCTCACACTATCTACCTGG + Intergenic
1052817032 9:33109749-33109771 CAATTCTGACACTGTCTGCCTGG - Intronic
1052911163 9:33883263-33883285 CATTGTTGACACTGTCTACCTGG + Intronic
1052950075 9:34201728-34201750 CAATGCCGACACTGTCTACCTGG + Intronic
1053608735 9:39687703-39687725 CAATTCTGACACTATCTACTTGG - Intergenic
1053866581 9:42444055-42444077 CAATTCTGACACTATCTACTTGG - Intergenic
1054244789 9:62654695-62654717 CAATTCTGACACTATCTACTTGG + Intergenic
1054558916 9:66689238-66689260 CAATTCTGACACTATCTACTTGG + Intergenic
1054918918 9:70522484-70522506 CAATTCTGACACTGTCTACCTGG + Intergenic
1055042756 9:71893258-71893280 CAATTCCAACATTATCTACCTGG + Intronic
1055185076 9:73441779-73441801 CAATTCTAACACTATCTTCCTGG + Intergenic
1055523667 9:77108307-77108329 CAGTTTTGACACTATCTACCTGG - Intergenic
1056086018 9:83149902-83149924 CAATTCTAACACTAACTACCAGG + Intergenic
1057006473 9:91565319-91565341 CAATTCTGACTCTATCTACCTGG + Intronic
1057021296 9:91699516-91699538 CAGTTCTGACACTGTCTACCTGG - Intronic
1057035316 9:91807649-91807671 CACTTTAGACACTGTCTACCTGG - Intronic
1057044309 9:91873126-91873148 CAATGTTGACACTGTGTATCCGG - Intronic
1057358431 9:94351271-94351293 CAATTCTGACACTATCTACCTGG - Intergenic
1057614086 9:96572397-96572419 CAATTCTGACACCATCTACCTGG - Intronic
1057649320 9:96906339-96906361 CAATTCTGACACTATCTACCTGG + Intronic
1057666645 9:97051052-97051074 TAATTCTGACACTATCTACCTGG - Intergenic
1057711435 9:97449284-97449306 TAATACTAACACTGTCTACCTGG + Intronic
1057711757 9:97451795-97451817 CAATTCTGACACTATCTACCTGG - Intronic
1059228609 9:112696546-112696568 CAATTCTGATACTATCTACCTGG + Intronic
1059472873 9:114519969-114519991 AAATTCTGACACTATCTACCTGG - Intergenic
1059708839 9:116848826-116848848 CAATTTTGACACTATCTAACTGG + Intronic
1059826468 9:118035271-118035293 CAATTTCGACACTGTCTACCTGG + Intergenic
1059892508 9:118818535-118818557 CAATTCCAACACTATCTACCTGG + Intergenic
1060033670 9:120236694-120236716 CACTTTTAAGACAGTCTAGCAGG - Intergenic
1060129204 9:121078565-121078587 CAATTCTGACACTGTCTACCTGG + Intronic
1060213852 9:121726600-121726622 CCATTTTGACATTATCTACCTGG - Intronic
1060374196 9:123104032-123104054 GAATTTAAACACTGTCAACGGGG - Exonic
1060904834 9:127295499-127295521 CAATTCTCACACCGACTACCTGG + Intronic
1186697021 X:12046420-12046442 AAATTCTGACACTATCTACCTGG + Intergenic
1186837189 X:13449887-13449909 CAATTCCAACACTATCTACCTGG + Intergenic
1187212003 X:17241139-17241161 CAACCTTCACACTGTCTAGCAGG - Intergenic
1188968483 X:36583483-36583505 CAATTCTGACACTAACTACCTGG + Intergenic
1189464118 X:41265108-41265130 CAATTCTGACACTCTCTACCTGG - Intergenic
1189510702 X:41658406-41658428 AAATTCAAACACTATCTACCTGG - Intronic
1189516565 X:41718485-41718507 CTATTCTGACACTATCTACCTGG - Intronic
1189709487 X:43795061-43795083 CAATTCTGACAGTATCTACCTGG + Intronic
1189831698 X:44981159-44981181 CAATTCTGACATTATCTACCTGG + Intronic
1189948509 X:46204414-46204436 CAAATTCAACACTATCTACCTGG - Intergenic
1189999959 X:46676263-46676285 CAGTTCTGACACTATCTACCTGG - Intronic
1190067850 X:47254742-47254764 CAATTCTAACACTAACTACCTGG + Intergenic
1190111919 X:47595458-47595480 CAATTCTGACACTATCTACCTGG - Intronic
1190377854 X:49807614-49807636 CAATTCTGACAGTATCTACCTGG + Intergenic
1191712457 X:64164878-64164900 CAATTCCAACACTATCTACCTGG - Intergenic
1192106278 X:68320682-68320704 CAATTATGACACTATCTACCTGG + Intronic
1192450154 X:71239759-71239781 CAATTTAAACAGTGGCTAACTGG + Exonic
1192704044 X:73510126-73510148 CAAATTTATCATTGTCTCCCAGG + Intergenic
1192886525 X:75341091-75341113 CAATTCTAACACTATCAATCTGG + Intergenic
1193155602 X:78170005-78170027 CAATTTTTACACTGTGTGCATGG + Intergenic
1193257890 X:79370972-79370994 GAATATAAACACTGACTACCTGG - Intergenic
1194871677 X:99140555-99140577 CAATTCTGACACTATCTATCTGG + Intergenic
1195118422 X:101723563-101723585 CAATTGTGACACTATCCACCTGG - Intergenic
1195383037 X:104288927-104288949 CAATTCTGACACTCTCTACCTGG - Intergenic
1196783635 X:119403885-119403907 CAGTTCTGACACTGTCTACCTGG + Intronic
1196801936 X:119551790-119551812 CAGTTCTGACACTGTCTACTCGG + Intronic
1196841372 X:119862256-119862278 CAATTCCAACATTGCCTACCTGG - Intergenic
1196884042 X:120225887-120225909 CAATTCTGACACTATCTACCTGG + Intergenic
1197803150 X:130373139-130373161 CAATGTTAACACTTTCTCTCGGG - Exonic
1198256905 X:134932033-134932055 GAATTCCAACACTCTCTACCTGG + Intergenic
1198279917 X:135131654-135131676 AGATTTTAACACTTTCTAGCTGG - Intergenic
1198291040 X:135240860-135240882 AGATTTTAACACTTTCTAGCTGG + Intergenic
1198736623 X:139792576-139792598 CACTTTTGATACTGCCTACCTGG - Intronic
1199174984 X:144776922-144776944 CAATTATTATACTATCTACCTGG + Intergenic
1200839601 Y:7767577-7767599 CAATTTCAACAAAGTTTACCAGG + Intergenic
1200892942 Y:8342921-8342943 CTATTTTAACAGTGTCTTCAGGG + Intergenic
1201720710 Y:17093994-17094016 CAGTTCTGACACTGTCTACATGG + Intergenic