ID: 1106619290

View in Genome Browser
Species Human (GRCh38)
Location 13:31358000-31358022
Sequence TAGCTAGCAGCAGTGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106619290_1106619294 20 Left 1106619290 13:31358000-31358022 CCTCCCACCACTGCTGCTAGCTA No data
Right 1106619294 13:31358043-31358065 CTATGCCAGACACCTTTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106619290 Original CRISPR TAGCTAGCAGCAGTGGTGGG AGG (reversed) Intergenic
No off target data available for this crispr