ID: 1106623350

View in Genome Browser
Species Human (GRCh38)
Location 13:31392991-31393013
Sequence AACAAGATTATGAAGTAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106623350_1106623353 27 Left 1106623350 13:31392991-31393013 CCAGTCTACTTCATAATCTTGTT No data
Right 1106623353 13:31393041-31393063 GCTTCACAAAGATAGGATGTTGG No data
1106623350_1106623352 20 Left 1106623350 13:31392991-31393013 CCAGTCTACTTCATAATCTTGTT No data
Right 1106623352 13:31393034-31393056 ACACTTTGCTTCACAAAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106623350 Original CRISPR AACAAGATTATGAAGTAGAC TGG (reversed) Intergenic