ID: 1106623352

View in Genome Browser
Species Human (GRCh38)
Location 13:31393034-31393056
Sequence ACACTTTGCTTCACAAAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106623350_1106623352 20 Left 1106623350 13:31392991-31393013 CCAGTCTACTTCATAATCTTGTT No data
Right 1106623352 13:31393034-31393056 ACACTTTGCTTCACAAAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106623352 Original CRISPR ACACTTTGCTTCACAAAGAT AGG Intergenic
No off target data available for this crispr