ID: 1106624388

View in Genome Browser
Species Human (GRCh38)
Location 13:31405603-31405625
Sequence TTTGTTAGGTCCGTTTTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106624385_1106624388 2 Left 1106624385 13:31405578-31405600 CCTTCACTCTTCTAAAAGTCCAT No data
Right 1106624388 13:31405603-31405625 TTTGTTAGGTCCGTTTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106624388 Original CRISPR TTTGTTAGGTCCGTTTTCCA TGG Intergenic
No off target data available for this crispr