ID: 1106625844

View in Genome Browser
Species Human (GRCh38)
Location 13:31420319-31420341
Sequence CTGGATACACACAGGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106625839_1106625844 12 Left 1106625839 13:31420284-31420306 CCTTCTCTCTATGGCCATGTATT No data
Right 1106625844 13:31420319-31420341 CTGGATACACACAGGAAGGAAGG No data
1106625840_1106625844 -2 Left 1106625840 13:31420298-31420320 CCATGTATTCAGAACTGCTAACT No data
Right 1106625844 13:31420319-31420341 CTGGATACACACAGGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106625844 Original CRISPR CTGGATACACACAGGAAGGA AGG Intergenic
No off target data available for this crispr