ID: 1106627738

View in Genome Browser
Species Human (GRCh38)
Location 13:31438049-31438071
Sequence TGTGATTCAAATTGATAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106627738_1106627742 17 Left 1106627738 13:31438049-31438071 CCCTGCTATCAATTTGAATCACA No data
Right 1106627742 13:31438089-31438111 CATAAAGAAAGTGTGGCCTGAGG No data
1106627738_1106627741 10 Left 1106627738 13:31438049-31438071 CCCTGCTATCAATTTGAATCACA No data
Right 1106627741 13:31438082-31438104 TGCTTCTCATAAAGAAAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106627738 Original CRISPR TGTGATTCAAATTGATAGCA GGG (reversed) Intergenic
No off target data available for this crispr