ID: 1106627742

View in Genome Browser
Species Human (GRCh38)
Location 13:31438089-31438111
Sequence CATAAAGAAAGTGTGGCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106627739_1106627742 16 Left 1106627739 13:31438050-31438072 CCTGCTATCAATTTGAATCACAG No data
Right 1106627742 13:31438089-31438111 CATAAAGAAAGTGTGGCCTGAGG No data
1106627738_1106627742 17 Left 1106627738 13:31438049-31438071 CCCTGCTATCAATTTGAATCACA No data
Right 1106627742 13:31438089-31438111 CATAAAGAAAGTGTGGCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106627742 Original CRISPR CATAAAGAAAGTGTGGCCTG AGG Intergenic
No off target data available for this crispr