ID: 1106628125

View in Genome Browser
Species Human (GRCh38)
Location 13:31441944-31441966
Sequence CCTTGGCAGGCACTGTGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106628122_1106628125 -8 Left 1106628122 13:31441929-31441951 CCTCAGCACGTCATGCCTTGGCA No data
Right 1106628125 13:31441944-31441966 CCTTGGCAGGCACTGTGTGCAGG No data
1106628118_1106628125 29 Left 1106628118 13:31441892-31441914 CCTTATCCTCATCAGCCTTCAAA No data
Right 1106628125 13:31441944-31441966 CCTTGGCAGGCACTGTGTGCAGG No data
1106628120_1106628125 14 Left 1106628120 13:31441907-31441929 CCTTCAAATTTGCAAACGTCTTC No data
Right 1106628125 13:31441944-31441966 CCTTGGCAGGCACTGTGTGCAGG No data
1106628119_1106628125 23 Left 1106628119 13:31441898-31441920 CCTCATCAGCCTTCAAATTTGCA No data
Right 1106628125 13:31441944-31441966 CCTTGGCAGGCACTGTGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106628125 Original CRISPR CCTTGGCAGGCACTGTGTGC AGG Intergenic
No off target data available for this crispr