ID: 1106633932

View in Genome Browser
Species Human (GRCh38)
Location 13:31507097-31507119
Sequence ACATATGACCTTCATTTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106633928_1106633932 17 Left 1106633928 13:31507057-31507079 CCACGGTTTGCTGTGTTTCTTTT No data
Right 1106633932 13:31507097-31507119 ACATATGACCTTCATTTGGGTGG No data
1106633929_1106633932 -6 Left 1106633929 13:31507080-31507102 CCAAGTTTCTGTTTCTAACATAT No data
Right 1106633932 13:31507097-31507119 ACATATGACCTTCATTTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106633932 Original CRISPR ACATATGACCTTCATTTGGG TGG Intergenic
No off target data available for this crispr