ID: 1106635696

View in Genome Browser
Species Human (GRCh38)
Location 13:31526205-31526227
Sequence AAATATCCACAAATGTGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106635696_1106635699 20 Left 1106635696 13:31526205-31526227 CCCTGCCACATTTGTGGATATTT No data
Right 1106635699 13:31526248-31526270 TTGCTACCTTTTCTATCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106635696 Original CRISPR AAATATCCACAAATGTGGCA GGG (reversed) Intergenic
No off target data available for this crispr