ID: 1106641299

View in Genome Browser
Species Human (GRCh38)
Location 13:31587078-31587100
Sequence AATGCTTAGTGGAACCATAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106641293_1106641299 -10 Left 1106641293 13:31587065-31587087 CCCCTACTAAGGCAATGCTTAGT No data
Right 1106641299 13:31587078-31587100 AATGCTTAGTGGAACCATAGGGG No data
1106641291_1106641299 4 Left 1106641291 13:31587051-31587073 CCACTGCAGAAAGACCCCTACTA No data
Right 1106641299 13:31587078-31587100 AATGCTTAGTGGAACCATAGGGG No data
1106641290_1106641299 17 Left 1106641290 13:31587038-31587060 CCTCAGGAGCGGGCCACTGCAGA No data
Right 1106641299 13:31587078-31587100 AATGCTTAGTGGAACCATAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106641299 Original CRISPR AATGCTTAGTGGAACCATAG GGG Intergenic
No off target data available for this crispr