ID: 1106641821

View in Genome Browser
Species Human (GRCh38)
Location 13:31592567-31592589
Sequence TCTCCTTGTGTTACACATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106641821_1106641825 9 Left 1106641821 13:31592567-31592589 CCCAAATGTGTAACACAAGGAGA No data
Right 1106641825 13:31592599-31592621 AAATCATTGTATTCATACCAGGG No data
1106641821_1106641824 8 Left 1106641821 13:31592567-31592589 CCCAAATGTGTAACACAAGGAGA No data
Right 1106641824 13:31592598-31592620 AAAATCATTGTATTCATACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106641821 Original CRISPR TCTCCTTGTGTTACACATTT GGG (reversed) Intergenic
No off target data available for this crispr