ID: 1106644667

View in Genome Browser
Species Human (GRCh38)
Location 13:31619239-31619261
Sequence TGCCCCACCATTATTAGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106644667_1106644669 5 Left 1106644667 13:31619239-31619261 CCAACTCTAATAATGGTGGGGCA No data
Right 1106644669 13:31619267-31619289 TTATAGCGAAACTTTAGTCCGGG No data
1106644667_1106644670 12 Left 1106644667 13:31619239-31619261 CCAACTCTAATAATGGTGGGGCA No data
Right 1106644670 13:31619274-31619296 GAAACTTTAGTCCGGGAGAATGG No data
1106644667_1106644668 4 Left 1106644667 13:31619239-31619261 CCAACTCTAATAATGGTGGGGCA No data
Right 1106644668 13:31619266-31619288 TTTATAGCGAAACTTTAGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106644667 Original CRISPR TGCCCCACCATTATTAGAGT TGG (reversed) Intergenic
No off target data available for this crispr