ID: 1106645665

View in Genome Browser
Species Human (GRCh38)
Location 13:31631051-31631073
Sequence GCCTACAGGTTAGCAGAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106645665_1106645670 25 Left 1106645665 13:31631051-31631073 CCTGATTCTGCTAACCTGTAGGC No data
Right 1106645670 13:31631099-31631121 GAACACCACTATTGTAGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106645665 Original CRISPR GCCTACAGGTTAGCAGAATC AGG (reversed) Intergenic
No off target data available for this crispr