ID: 1106646782

View in Genome Browser
Species Human (GRCh38)
Location 13:31643556-31643578
Sequence CAGAGAAAACAGAAGTATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106646781_1106646782 -4 Left 1106646781 13:31643537-31643559 CCAATAGCATAAAAGAGGACAGA No data
Right 1106646782 13:31643556-31643578 CAGAGAAAACAGAAGTATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106646782 Original CRISPR CAGAGAAAACAGAAGTATAT AGG Intergenic
No off target data available for this crispr