ID: 1106647734

View in Genome Browser
Species Human (GRCh38)
Location 13:31654849-31654871
Sequence CTTAACAATTCATTGATTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106647734_1106647736 -9 Left 1106647734 13:31654849-31654871 CCACAAATCAATGAATTGTTAAG No data
Right 1106647736 13:31654863-31654885 ATTGTTAAGGAGAGCCCAATAGG No data
1106647734_1106647738 -7 Left 1106647734 13:31654849-31654871 CCACAAATCAATGAATTGTTAAG No data
Right 1106647738 13:31654865-31654887 TGTTAAGGAGAGCCCAATAGGGG No data
1106647734_1106647737 -8 Left 1106647734 13:31654849-31654871 CCACAAATCAATGAATTGTTAAG No data
Right 1106647737 13:31654864-31654886 TTGTTAAGGAGAGCCCAATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106647734 Original CRISPR CTTAACAATTCATTGATTTG TGG (reversed) Intergenic
No off target data available for this crispr