ID: 1106647738

View in Genome Browser
Species Human (GRCh38)
Location 13:31654865-31654887
Sequence TGTTAAGGAGAGCCCAATAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106647734_1106647738 -7 Left 1106647734 13:31654849-31654871 CCACAAATCAATGAATTGTTAAG No data
Right 1106647738 13:31654865-31654887 TGTTAAGGAGAGCCCAATAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106647738 Original CRISPR TGTTAAGGAGAGCCCAATAG GGG Intergenic
No off target data available for this crispr