ID: 1106651933

View in Genome Browser
Species Human (GRCh38)
Location 13:31700632-31700654
Sequence AGTGAGTTAGATCTCATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106651933_1106651937 10 Left 1106651933 13:31700632-31700654 CCTCCCATGAGATCTAACTCACT No data
Right 1106651937 13:31700665-31700687 CAACATTAATTCCTTTATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106651933 Original CRISPR AGTGAGTTAGATCTCATGGG AGG (reversed) Intergenic
No off target data available for this crispr