ID: 1106653835

View in Genome Browser
Species Human (GRCh38)
Location 13:31721053-31721075
Sequence GAGAAAAAGGAGGAGGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106653835_1106653845 18 Left 1106653835 13:31721053-31721075 CCTGGCACCTCCTCCTTTTTCTC No data
Right 1106653845 13:31721094-31721116 CCTTCACCTTCCACCATGAGTGG 0: 51
1: 210
2: 455
3: 810
4: 1460

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106653835 Original CRISPR GAGAAAAAGGAGGAGGTGCC AGG (reversed) Intergenic
No off target data available for this crispr