ID: 1106656464

View in Genome Browser
Species Human (GRCh38)
Location 13:31752243-31752265
Sequence AGTCATCTGAAGAAGGAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 325}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106656457_1106656464 3 Left 1106656457 13:31752217-31752239 CCAAATCTGTCTTTCAAACATTA 0: 1
1: 1
2: 2
3: 33
4: 383
Right 1106656464 13:31752243-31752265 AGTCATCTGAAGAAGGAGGGGGG 0: 1
1: 0
2: 0
3: 28
4: 325
1106656454_1106656464 26 Left 1106656454 13:31752194-31752216 CCACAAAGTTAGGCAGCATTTCC 0: 1
1: 0
2: 1
3: 13
4: 139
Right 1106656464 13:31752243-31752265 AGTCATCTGAAGAAGGAGGGGGG 0: 1
1: 0
2: 0
3: 28
4: 325
1106656455_1106656464 5 Left 1106656455 13:31752215-31752237 CCCCAAATCTGTCTTTCAAACAT 0: 1
1: 0
2: 7
3: 97
4: 826
Right 1106656464 13:31752243-31752265 AGTCATCTGAAGAAGGAGGGGGG 0: 1
1: 0
2: 0
3: 28
4: 325
1106656456_1106656464 4 Left 1106656456 13:31752216-31752238 CCCAAATCTGTCTTTCAAACATT 0: 1
1: 0
2: 5
3: 66
4: 725
Right 1106656464 13:31752243-31752265 AGTCATCTGAAGAAGGAGGGGGG 0: 1
1: 0
2: 0
3: 28
4: 325

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106656464 Original CRISPR AGTCATCTGAAGAAGGAGGG GGG Intronic
901530769 1:9851148-9851170 AGTCTTGAGAAGAAAGAGGGAGG - Intronic
904993406 1:34612444-34612466 AGCCATGTGAAGAACGGGGGAGG - Intergenic
905457019 1:38095221-38095243 AATCCTTTGAAGAAGGAGGCTGG - Intergenic
905465224 1:38148097-38148119 AGTTATCTGAAGAAGATGGTAGG - Intergenic
905562080 1:38935489-38935511 CATCATCTGTAAAAGGAGGGTGG + Intronic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
907676061 1:56518991-56519013 AGGCTTCTAAAGAAGGTGGGTGG + Intronic
907738554 1:57140327-57140349 CCTCATCTGTAGAATGAGGGAGG - Intronic
909542716 1:76808413-76808435 TGTCATCTCATGGAGGAGGGTGG - Intergenic
910259431 1:85281452-85281474 GGTCATGTGAAGATGGAGGCTGG - Intergenic
910604021 1:89063724-89063746 AATCATTTGAAGATGGAGGAAGG - Intronic
910948213 1:92616686-92616708 AGTTATCTGAAGAAGATGGCAGG - Intronic
911962315 1:104321037-104321059 AGTTATGTGAAGAATGATGGTGG + Intergenic
912304529 1:108553789-108553811 AGACTTCTGGAGAAGGATGGGGG + Intergenic
912587254 1:110778355-110778377 TGTCATCTGAAGAGGTAGGCAGG + Intergenic
912733324 1:112128831-112128853 AGTCATCTGCAGAAGATGGCAGG + Intergenic
912861946 1:113221154-113221176 ATTCTTCTGAAGGAGAAGGGAGG - Intergenic
913198947 1:116480673-116480695 AGTCCTCTGGAGATGGATGGTGG + Intergenic
914386913 1:147178489-147178511 AGCCACCTGAAGAAGCAGGCAGG + Intronic
915482975 1:156199792-156199814 AGGGATGTGAAGAAGGAGGGTGG - Intronic
915579010 1:156802224-156802246 AGTGAACTGAAGGAGGTGGGAGG - Intergenic
916193684 1:162203501-162203523 AGTCATTAGAAGAAGGAGTGTGG + Intronic
918529845 1:185506330-185506352 AGTTCTGTGAAGAAGGACGGTGG + Intergenic
918771173 1:188562222-188562244 AGACATCTGAAGAAGGTGGAAGG + Intergenic
919497757 1:198297207-198297229 AGTGATCTGAAGGAAGAGGTGGG - Exonic
920759407 1:208767808-208767830 AGCCACCTGAAAAAGAAGGGAGG - Intergenic
922083184 1:222318213-222318235 ATGCATGTGGAGAAGGAGGGCGG - Intergenic
922183749 1:223256494-223256516 AGTCATCTGCAGGAGGAGAGCGG - Intronic
923841601 1:237678309-237678331 AGTCATTTGAAGAAGGAATGCGG - Intronic
924311212 1:242744966-242744988 TGACATCTGAATACGGAGGGAGG - Intergenic
924331286 1:242943206-242943228 AGTCTTCTGAAGAGGGCAGGAGG + Intergenic
1063472488 10:6299359-6299381 AGTCAGCTGACCCAGGAGGGTGG + Intergenic
1064020128 10:11802382-11802404 AGCCAACTGCAGAAGGAGAGAGG + Intergenic
1064818807 10:19299897-19299919 AGGCATCTGAATAAGAAGAGAGG + Intronic
1065123623 10:22551827-22551849 ATTGCTCTGAATAAGGAGGGAGG - Intronic
1065699473 10:28410940-28410962 AGAAATCTGAAGAAGAAGAGGGG + Intergenic
1066573682 10:36802243-36802265 TGCCATCTCACGAAGGAGGGTGG - Intergenic
1067371594 10:45688813-45688835 AGTTCTGTGAAGAAGGATGGTGG + Intergenic
1067388189 10:45837335-45837357 AGTTCTGTGAAGAAGGATGGTGG - Intronic
1067446076 10:46347267-46347289 AGTTCTGTGAAGAAGGATGGTGG + Intergenic
1067503292 10:46826508-46826530 AGTTCTGTGAAGAAGGATGGTGG + Intergenic
1067591303 10:47513503-47513525 AGTTCTGTGAAGAAGGATGGTGG - Intronic
1067638420 10:48021596-48021618 AGTTCTGTGAAGAAGGATGGTGG - Intergenic
1068099229 10:52531280-52531302 AGTCCTGTGAAGAATGATGGTGG - Intergenic
1068447208 10:57138591-57138613 AGTTATCTGAAGAAGATGGCAGG - Intergenic
1070135024 10:73686022-73686044 AGTTCTGTGAAGAAGGATGGTGG - Intronic
1070661492 10:78309644-78309666 AAACATCTCAAGAAGGAGGTAGG + Intergenic
1070807791 10:79280683-79280705 AGTCATCAGAAGAATGGGGTGGG - Intronic
1072804074 10:98413417-98413439 TGTCATTTAAAGAAGGAGGCCGG + Intronic
1073316043 10:102581598-102581620 AGCCTTCTCAGGAAGGAGGGCGG + Intronic
1074147067 10:110726159-110726181 AGTCATCAGGAGCAGGAGGCTGG - Intronic
1074482475 10:113837172-113837194 AGTCATTTGAAGAAGTGTGGTGG - Exonic
1074847162 10:117408504-117408526 GGTCATGTGAAGATGGAGGCAGG + Intergenic
1075198652 10:120382936-120382958 AGTCCTCTGGAGAGGGAGTGAGG + Intergenic
1075786059 10:125050937-125050959 AGACATCTGGATGAGGAGGGTGG + Intronic
1076823925 10:132957869-132957891 TCTCATCTGAAGACCGAGGGAGG + Intergenic
1078332957 11:10441025-10441047 ACTCCCCTGAAGAAGGAGGAGGG + Intronic
1078731921 11:13982864-13982886 AATCCTCTGAAGTAGGAGGGAGG - Exonic
1079413987 11:20215793-20215815 ACTCTTCTGAGGAAAGAGGGAGG + Intergenic
1079612415 11:22449562-22449584 AGCCATGTGAAGAAGAAGGCAGG + Intergenic
1081223332 11:40490008-40490030 AGGCAACTGAGGAAGGAGAGTGG - Intronic
1081638312 11:44735519-44735541 TGTCATGTGATGATGGAGGGAGG - Intronic
1083119856 11:60500898-60500920 ACACATCTGAAGCAGGAGGTGGG - Intronic
1084396786 11:68916337-68916359 AGTCGGCTGGAGAAGTAGGGTGG + Intronic
1084634646 11:70383008-70383030 AATCATCTGTAGAAGTAGTGTGG - Exonic
1084875476 11:72129177-72129199 AGTCATGTGAACATGGAGGAAGG - Intronic
1085618742 11:78021976-78021998 ATTCATCTGAAGGATGAGTGGGG - Intronic
1085751940 11:79169368-79169390 AGTGATCGCAAGAGGGAGGGCGG + Intronic
1086299733 11:85413923-85413945 AGTTCTCTGAAGAATGATGGTGG + Intronic
1087701601 11:101441808-101441830 AGGCCTCTGAAGAAGTAGGCGGG - Intergenic
1089340583 11:117754695-117754717 AGTCATATGGGGAAGGAGGAGGG + Intronic
1089698501 11:120230068-120230090 AGCCATTTGAGGAAGGAAGGAGG + Exonic
1090209495 11:124908075-124908097 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1090483562 11:127090135-127090157 AGTTCTGTGAAGAAGGATGGTGG - Intergenic
1091540311 12:1454456-1454478 TGGCATCTGAAGCTGGAGGGTGG + Intronic
1091948500 12:4571028-4571050 AGTCATCTCAAGCAGTAGGCTGG + Intronic
1093183608 12:15994908-15994930 AGTAATCCCAAGAGGGAGGGAGG + Intronic
1094383685 12:29870693-29870715 ATGCTTCTTAAGAAGGAGGGTGG + Intergenic
1094486350 12:30928455-30928477 ACTGGGCTGAAGAAGGAGGGAGG + Intronic
1094789634 12:33896960-33896982 AGTTATGTGAAGAATGATGGTGG - Intergenic
1095041493 12:37446657-37446679 AGTCAGGTGAATAAGAAGGGAGG - Intergenic
1097603677 12:61726260-61726282 AGTTATATGAAGAATGATGGTGG + Intronic
1097821385 12:64132191-64132213 AGTTATCTGCAGAAGAAGGCAGG + Intronic
1098392230 12:69981538-69981560 AGTCCTCTGATGGAGGAGGAGGG - Intergenic
1099104796 12:78484774-78484796 GCTCATGTGAATAAGGAGGGGGG - Intergenic
1099803863 12:87492653-87492675 ACACAGCTGAAGCAGGAGGGAGG - Intergenic
1102454010 12:113060461-113060483 AGAGATCTGAAGAATGAGTGAGG + Intronic
1103285897 12:119801504-119801526 AGTGATCTGAAAGACGAGGGAGG - Intronic
1103500397 12:121397324-121397346 AGGTCTCTGAAGGAGGAGGGGGG - Intronic
1104343652 12:127976271-127976293 AGTTCTGTGAAGAATGAGGGTGG - Intergenic
1104421250 12:128637445-128637467 AGTCATCTGAGGGAGGGGGAAGG - Intronic
1104754077 12:131258179-131258201 AGAGACCTGAACAAGGAGGGGGG + Intergenic
1104857856 12:131910237-131910259 ACTCATCTGCAGGAGGAAGGAGG - Exonic
1105538836 13:21297201-21297223 AGCCACCTGAAGATGGAGGCGGG - Intergenic
1105799416 13:23890363-23890385 AGCCACCTGAAGATGGAGGCGGG + Intergenic
1105849632 13:24322675-24322697 AGCCACCTGAAGATGGAGGCGGG - Intergenic
1106381846 13:29246873-29246895 AGTTATGTGAAGAAAGATGGTGG - Intronic
1106656464 13:31752243-31752265 AGTCATCTGAAGAAGGAGGGGGG + Intronic
1107030687 13:35850746-35850768 AGTCATCCGAAGAGAGGGGGCGG + Intronic
1108391098 13:49948514-49948536 AGTTCTGTGAAGAAGGATGGTGG - Intergenic
1108433123 13:50374650-50374672 AGTAATCTGAAAATGAAGGGTGG + Intronic
1109251785 13:60029307-60029329 AGTCACATGAATTAGGAGGGTGG - Intronic
1112483422 13:99798144-99798166 ACCTATCTGAAGAAGGAGGGAGG + Intronic
1113120912 13:106923135-106923157 AGTCATCTCAAAAATGAAGGAGG + Intergenic
1113281161 13:108789407-108789429 AGTCCTCTGAAAAATGAAGGGGG - Intronic
1115298801 14:31860388-31860410 AATGCTCTGAAAAAGGAGGGGGG - Exonic
1116068091 14:40009144-40009166 AGTTATCTGAAGAAGATGGGAGG - Intergenic
1117011814 14:51478556-51478578 ATTGATCTGAAGTGGGAGGGAGG + Intergenic
1117336031 14:54758061-54758083 TGTCATGTGTAGAAGGAAGGTGG + Intronic
1119705943 14:76782604-76782626 AGTCCTCTGAAGGAGTGGGGAGG + Exonic
1119757311 14:77128230-77128252 AGTGATCAGAGGAAGGAGGCAGG + Intronic
1119877050 14:78069837-78069859 GGTCATGTGAAGATGGAGGTAGG + Intergenic
1120091571 14:80338251-80338273 GGTCATATGAAGAATCAGGGAGG + Intronic
1120253331 14:82087738-82087760 ACTAATTTGAAGAAGAAGGGGGG + Intergenic
1120465527 14:84852382-84852404 AGTCATCTAAAGAAGAGGTGTGG + Intergenic
1120583973 14:86287671-86287693 AGTCATTAGGAGAGGGAGGGTGG + Intergenic
1120880485 14:89412112-89412134 AGGCAGCTGAAGGAGTAGGGGGG + Exonic
1121241137 14:92430812-92430834 AGAAATCTGAAGGTGGAGGGAGG - Intronic
1121704952 14:95984749-95984771 AGTCATCTGGAGTAGTAGGTAGG - Intergenic
1121890579 14:97586778-97586800 AGTCATTTGATGAGGGAGGAAGG - Intergenic
1123880322 15:24672931-24672953 AGTTATCTGAAAAAGGAATGTGG - Intergenic
1124783308 15:32656273-32656295 CGTCATCTGGAAAAAGAGGGAGG + Intronic
1124805071 15:32873610-32873632 AAGCATCTGAGGAAGGATGGGGG + Intronic
1125230658 15:37451799-37451821 AGTCATTTGAATCATGAGGGTGG + Intergenic
1125436893 15:39655715-39655737 GGGCATCTGAATAAGGAGGATGG - Intronic
1125476488 15:40051170-40051192 AGCCAACAGAGGAAGGAGGGAGG + Intergenic
1128904042 15:71451733-71451755 AGGGACCTGGAGAAGGAGGGAGG - Intronic
1129785425 15:78306898-78306920 TGGCATCTGTAGAAGGAGAGGGG - Intergenic
1130919955 15:88335558-88335580 AATCATCAGATGAAGGAGGGAGG + Intergenic
1130965465 15:88694475-88694497 CGGCATGTGAAGAAGGAGAGGGG + Intergenic
1131329594 15:91484774-91484796 AGACATCTGAAAAAGGGGGGAGG + Intergenic
1131769953 15:95726732-95726754 TGACATCTGAAGAAGCTGGGAGG + Intergenic
1131838457 15:96413027-96413049 ACTCCTCTAAAGAAGGAGGTTGG + Intergenic
1131946278 15:97625634-97625656 AGTCAGCTGCAGATGGAGGTAGG + Intergenic
1133085392 16:3358323-3358345 AATCATTTGAAGCTGGAGGGTGG + Intergenic
1133317458 16:4893365-4893387 AGGCATCTGTGGAGGGAGGGAGG + Exonic
1133602433 16:7352453-7352475 TGTCATCTGAAGACGTGGGGTGG + Intronic
1135545963 16:23366954-23366976 AGTCATCAGAAGAGGCAAGGAGG + Intronic
1135712826 16:24732182-24732204 AGTGTTCTGAGGAAGGAGAGAGG + Intronic
1135785383 16:25344271-25344293 AGACATCGCATGAAGGAGGGGGG + Intergenic
1136541216 16:30928485-30928507 AGGCACCTGAAGAAGGTGGGTGG + Exonic
1137309754 16:47243634-47243656 AGGTATCAGAAGAATGAGGGAGG + Intronic
1138250203 16:55496335-55496357 AGTTTTGTGAAGAAGGATGGTGG + Intronic
1138587736 16:57982069-57982091 AATCAACTGAAGCAGGAGGAAGG - Intronic
1138756205 16:59488815-59488837 AGTTATCTAAAGAGAGAGGGGGG + Intergenic
1138998858 16:62484493-62484515 TGACATCTGAAGTAGGAGGGGGG - Intergenic
1140778590 16:78273570-78273592 AGCCATGTGAGAAAGGAGGGTGG + Intronic
1141425749 16:83943407-83943429 AGTTTTCTGCAGAATGAGGGAGG + Intronic
1141519286 16:84566873-84566895 AGCGAGCTGAAGAAGGCGGGGGG - Exonic
1141888953 16:86913684-86913706 CTTCATATGAAGAGGGAGGGTGG - Intergenic
1143178713 17:4971191-4971213 AGTGATCTGATGCAGGAAGGAGG - Intronic
1143930565 17:10419142-10419164 AATCACTTGAAGCAGGAGGGCGG - Intronic
1145382815 17:22395869-22395891 AGTCTTCCAAAGGAGGAGGGAGG + Intergenic
1145983321 17:29027372-29027394 AGTCAGCAGAGGAAGGAGGCTGG - Intronic
1146320774 17:31844747-31844769 AGACTTCTGAAGATGGACGGTGG - Intergenic
1146563189 17:33889232-33889254 CTTCATCTGAAAAACGAGGGGGG - Intronic
1147655788 17:42090168-42090190 AGCCATGAGAAGGAGGAGGGAGG - Intergenic
1148488252 17:48005236-48005258 AGTCAGCCGAGGAAGGATGGGGG - Intergenic
1148625861 17:49068502-49068524 AGCCATCTGAGCAAGGGGGGCGG - Intergenic
1148825600 17:50391646-50391668 AGTCATCTGACATAGGAGTGAGG - Intronic
1149496149 17:57118965-57118987 TGTCACCTGAAGAAGGGGGGTGG - Exonic
1152019003 17:77770772-77770794 CGTCATCTGATGACGCAGGGAGG + Intergenic
1152055352 17:78021122-78021144 AGGTAGCTGAAGAAGGAGGCTGG + Intronic
1154068461 18:11131068-11131090 AGTTATCTGCAGAAGGTGGCAGG - Intronic
1156572573 18:38275010-38275032 AGCCATTTGAAGGTGGAGGGTGG + Intergenic
1156620939 18:38850834-38850856 AGTGATGTGGAGAAGGAGGGTGG - Intergenic
1156921031 18:42522579-42522601 GGTCCTCAGAAGAAGGAGGCAGG + Intergenic
1158683778 18:59594221-59594243 ATTCATTTGTAGAAGGAGGACGG - Intronic
1159104139 18:63986376-63986398 TTTCATCTGAAGATGAAGGGAGG - Intronic
1160018116 18:75159308-75159330 AGGCGGCAGAAGAAGGAGGGTGG + Intergenic
1161805832 19:6442433-6442455 AGTCAGCTGGGAAAGGAGGGAGG - Intronic
1162139713 19:8578438-8578460 GGTCATCTAAAGAGGGAGGTTGG - Intergenic
1162572573 19:11481532-11481554 AGTCTTCTGCAGAAGGAGACTGG + Intronic
1162584969 19:11552983-11553005 GGTCACCAGAAGAAGGAGAGGGG - Intronic
1166252195 19:41578893-41578915 AGTTCTCTGATGAAGGAGGGAGG + Intronic
1166255832 19:41603883-41603905 AGTTCTCTCATGAAGGAGGGAGG - Intronic
1166258819 19:41624139-41624161 AGTTCTCTTATGAAGGAGGGAGG - Intronic
1166258835 19:41624259-41624281 AGTTCTCTCATGAAGGAGGGAGG - Intronic
1166266120 19:41685554-41685576 AGTTCTCTCATGAAGGAGGGAGG - Intronic
925093427 2:1173667-1173689 AGGCTTCTGAGGGAGGAGGGCGG - Intronic
925198490 2:1947255-1947277 AGCCATCTTGAAAAGGAGGGCGG - Intronic
926561640 2:14424235-14424257 AGTCATCTGAAGAGGCAGTGAGG + Intergenic
927863185 2:26573233-26573255 AGTGAGCTCCAGAAGGAGGGAGG + Intronic
930476066 2:51883817-51883839 AGGCATCTAAATAAGGAGAGAGG - Intergenic
930798531 2:55419348-55419370 AGGCATCTGGAGGAGGAGGAAGG + Exonic
931569716 2:63656001-63656023 ATTAATCTGATGAAGGACGGGGG + Intronic
932062491 2:68520842-68520864 AGTCCTGTGAAGAATGATGGTGG + Intronic
932165762 2:69505053-69505075 AGACTTCTAAAAAAGGAGGGAGG - Intronic
933823200 2:86133962-86133984 AGTCGTGTGAAGCAGGAGGGCGG - Intronic
934079921 2:88458981-88459003 AGTCTAATGAAGAAGGAGGAGGG - Intergenic
935061386 2:99611185-99611207 AGACAACTGAAAAAGTAGGGGGG - Intronic
936092898 2:109512327-109512349 GGGCATCAGAAGAAGGAGGAAGG - Intergenic
936401944 2:112171316-112171338 AGTCAAATGGAGAAGGAGGAGGG + Intronic
937674019 2:124569414-124569436 AGTCATCTGAAAAAAGATTGTGG - Intronic
937751785 2:125484253-125484275 AGTCTTGTGAAGAATGATGGTGG + Intergenic
938107704 2:128544638-128544660 AGTCATCTCCAGGAGGTGGGGGG + Intergenic
938316811 2:130335306-130335328 ATTTATCTGACTAAGGAGGGAGG + Intergenic
942482211 2:176401624-176401646 AGTAAAATGAAGATGGAGGGAGG - Intergenic
943213046 2:184992854-184992876 AGATATCTGAAAAAGGAAGGTGG + Intergenic
943282925 2:185960660-185960682 AGTTATATGAAGAATGATGGTGG - Intergenic
944306231 2:198183248-198183270 AGTCATCTTCAGAAAAAGGGAGG + Intronic
944815205 2:203369142-203369164 GGTTTTCTGTAGAAGGAGGGAGG + Intronic
947067576 2:226246428-226246450 ATTCAGCTGAAGACAGAGGGGGG + Intergenic
948389060 2:237598975-237598997 AGCCATGTGAAGACGGAGGCAGG - Intronic
1168786896 20:547317-547339 AGTCATGTGTATAAGGAGGGTGG + Intergenic
1168854148 20:997191-997213 AGGCCACTGAGGAAGGAGGGAGG - Intronic
1169020969 20:2330542-2330564 AGTCATCTGCAGAGGCAGAGAGG - Intronic
1170487717 20:16836452-16836474 AGTTATGTGAAGAATGACGGTGG - Intergenic
1170967506 20:21088155-21088177 TCTCATCTGAAGGAGGAAGGAGG - Intergenic
1171122856 20:22581095-22581117 AATTATTTCAAGAAGGAGGGAGG - Exonic
1171436116 20:25125919-25125941 AGTCATCTGAGGAAGATGGCAGG - Intergenic
1173852928 20:46230097-46230119 TGACTTCTGAAGAAGGTGGGAGG - Intronic
1174520986 20:51130474-51130496 CCTCATCTGAAGAAGGGGGTCGG + Intergenic
1174792779 20:53496016-53496038 AGTCAGCTGAGGAATGAGGGAGG + Intergenic
1175149300 20:56920568-56920590 AATCATCTGGAGAAGGGGTGAGG + Intergenic
1175817572 20:61891468-61891490 AGTCACCTGGAGAAGGGGGGAGG - Intronic
1177661544 21:24090093-24090115 AGTCCTGTGAAGAATGATGGTGG - Intergenic
1179415153 21:41192550-41192572 AGTTATCTGAAGAAGATGGCAGG + Intronic
1180988034 22:19917159-19917181 AGCCACCTGCAGAAGGAGGCTGG - Intronic
1182080138 22:27522956-27522978 GGTTATCTGGAGAAGGAGGTGGG + Intergenic
1183083947 22:35475082-35475104 AGTCATCTGAATAAAGACGGAGG + Intergenic
1184107508 22:42376753-42376775 AGGCAGCTGAGGCAGGAGGGAGG + Intergenic
1184571027 22:45325091-45325113 CGTCATAGGAAGAAGAAGGGAGG + Intronic
1185184010 22:49381767-49381789 AGTTAACAGGAGAAGGAGGGCGG - Intergenic
949245863 3:1924893-1924915 AGTTATCTGCAGAAGGTGGCGGG - Intergenic
953208087 3:40849657-40849679 TTTCATCTCCAGAAGGAGGGAGG + Intergenic
955044855 3:55350260-55350282 AGACATCTGAGGAATGAGGCTGG - Intergenic
955126018 3:56113736-56113758 TGGCATCTGAAGTGGGAGGGTGG - Intronic
956756296 3:72391045-72391067 TGGCATGTGAAGAATGAGGGTGG - Intronic
959280066 3:104326026-104326048 AGACATCTGAAAAAGGGGAGAGG - Intergenic
959878138 3:111411057-111411079 AGTTCTCTGAAGAACGATGGTGG - Intronic
959931029 3:111982686-111982708 TGTCATCAAAAGAAGGAGGTTGG + Intronic
959932986 3:112002910-112002932 ACTCCTCTAAAGAAAGAGGGAGG + Intronic
960945085 3:122960871-122960893 AGTGTTCTGGAGATGGAGGGTGG + Intronic
961003407 3:123389016-123389038 AGTCATGGAAGGAAGGAGGGAGG + Intronic
961804732 3:129481370-129481392 ACTCATCAAAAGAAAGAGGGGGG - Intronic
962010714 3:131387711-131387733 AGAGACCTGAAGAAGGTGGGAGG - Intronic
963661389 3:148132115-148132137 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
964908388 3:161746864-161746886 AGACATCTGAAGAGTGAGAGAGG + Intergenic
965690842 3:171355275-171355297 ATTCATATGGAGCAGGAGGGAGG + Intronic
966025276 3:175271703-175271725 AATCATTTGAACAAGGGGGGAGG + Intronic
966208683 3:177430555-177430577 AGTGCCCTGAAGAATGAGGGGGG - Intergenic
966545277 3:181139189-181139211 AACCAAGTGAAGAAGGAGGGTGG - Intergenic
966731279 3:183153363-183153385 AGTCTTCTGGAGTGGGAGGGAGG + Intronic
971358525 4:25915657-25915679 CGTCCGCTGAAGAAGGATGGTGG - Intronic
973103143 4:46296416-46296438 AGTCAACAGAATAAGAAGGGAGG + Intronic
974772090 4:66429529-66429551 ATTCATCTGGAGAATGATGGAGG + Intergenic
975257750 4:72257590-72257612 ATTTGTGTGAAGAAGGAGGGTGG - Intergenic
975301244 4:72793747-72793769 AGTTCTGTGAAGAAGGATGGTGG - Intergenic
980019636 4:127693104-127693126 AGTTATGTGAAGAATGATGGTGG + Intronic
981362398 4:143862843-143862865 AGTCTTCTGAGGAAGGAAGCAGG + Intergenic
981373128 4:143983611-143983633 AGTCTTCTGAGGAAGGAAGTAGG + Intergenic
981382223 4:144086886-144086908 AGTCTTCTGAGGAAGGAAGCAGG + Intergenic
983376696 4:166938161-166938183 TGTCATCTGAAGAATGACAGAGG + Intronic
984247039 4:177287133-177287155 AGTCACCTGTAGAATGAGGAAGG - Intergenic
984477827 4:180259369-180259391 AATCATCTCAATAAGGAGGAGGG + Intergenic
984645008 4:182209882-182209904 AGTCATCTGCAGGGGGAGGTGGG + Intronic
984657195 4:182330928-182330950 TCTCATCTGAAGAGGGAGAGTGG + Intronic
985938901 5:3118483-3118505 GGGCAACTGCAGAAGGAGGGTGG - Intergenic
987526259 5:19053714-19053736 AGCCTTCTGAAGAAGGATGTGGG + Intergenic
987589244 5:19902382-19902404 AGCCATTTCAAGAGGGAGGGAGG - Intronic
988735892 5:34020930-34020952 AGTCATAAGAAGGAGCAGGGAGG - Intronic
988913073 5:35865105-35865127 AGTCATAGGTGGAAGGAGGGGGG - Intronic
989355083 5:40534851-40534873 AGTTCTGTGAAGAATGAGGGTGG + Intergenic
990057657 5:51604210-51604232 AGTCTTCTGAAGAATGTTGGTGG - Intergenic
992242936 5:74789722-74789744 AGTTATCTGAAGAAGATGGCAGG - Intronic
992335630 5:75765969-75765991 AGTTCTCTGAAGAATGATGGTGG + Intergenic
992697313 5:79302950-79302972 AGTGATGTGGTGAAGGAGGGAGG + Intronic
995422002 5:111978209-111978231 AGTCCTCTGAATTAGCAGGGAGG - Intronic
996018556 5:118567827-118567849 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
996828794 5:127716719-127716741 AATCCTATGAAGAAGGAGGTGGG - Intergenic
998746462 5:145265434-145265456 AGTTGTGTGAAGAAGGATGGTGG - Intergenic
1000549229 5:162638509-162638531 ACTTATCTGAAGATTGAGGGAGG - Intergenic
1000890240 5:166793073-166793095 AGTCATCTAAAGACGGCTGGGGG + Intergenic
1002701198 5:181126203-181126225 ACCCATCAGAAAAAGGAGGGTGG - Intergenic
1003141050 6:3471607-3471629 GGTCATCGGAGGAAGGAGAGGGG - Intergenic
1003434944 6:6079438-6079460 CGTCAACTGAAGAAGAAGGGAGG + Intergenic
1003695901 6:8406168-8406190 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1004022587 6:11788584-11788606 AGTCATCTGGAGAAGTCGAGAGG + Intronic
1005687358 6:28267485-28267507 AGAAATCTGAAGGAGGTGGGTGG + Intronic
1005943287 6:30577515-30577537 AGCCATGTGAAGGAGGTGGGAGG + Intronic
1006651468 6:35555158-35555180 ACTCAGCTGAGGATGGAGGGAGG + Intergenic
1007170609 6:39860645-39860667 GGTGACCTGAAGCAGGAGGGTGG + Intronic
1009734337 6:67657156-67657178 AGTGATGTGAAGAAGAAAGGTGG + Intergenic
1010858207 6:80870359-80870381 AGTTATGTGAAGAATGATGGTGG - Intergenic
1011445678 6:87436561-87436583 AGTCATCTGAGGAGGGTGGGGGG + Intronic
1011616034 6:89199222-89199244 AGCCATCTGAAAAAGTAGTGTGG + Intronic
1012108574 6:95197765-95197787 AGTTATCTGCAGAAGGTGGGAGG + Intergenic
1012415155 6:99005115-99005137 AGTCTTGTGAAGAAGAGGGGAGG - Intergenic
1013324996 6:109036142-109036164 AGTCATCAGAATGGGGAGGGAGG + Intronic
1013554564 6:111242823-111242845 TGTCAACTGAAGAACGATGGAGG + Intergenic
1014723529 6:124948983-124949005 AGTGACCTGAAGAAAGTGGGGGG + Intergenic
1015054053 6:128877945-128877967 ACTCATCTCAAGAAGAAGCGCGG + Intergenic
1016250802 6:142039503-142039525 AGTCATTTCAAGAGGAAGGGAGG + Intergenic
1017035371 6:150262428-150262450 AGGGTTATGAAGAAGGAGGGTGG - Intergenic
1019541928 7:1555479-1555501 ACTCATCTGCAGAGGGAGGGAGG + Exonic
1024177483 7:46856011-46856033 AGGCATCTGATGAGGGAAGGAGG - Intergenic
1024866099 7:53906315-53906337 AGTTATCTGAAAAAGGTGGCAGG - Intergenic
1026641611 7:72131202-72131224 AGAAATCTGAAGAGGGAGGTGGG + Intronic
1028582682 7:92423539-92423561 AGTCATCTGGAGAGGAAGGCTGG - Intergenic
1031528897 7:122853122-122853144 AGTCATGTGAAATAGGAGGGAGG - Intronic
1035661665 8:1352680-1352702 AGTCATGTAAAGAAGGAACGTGG - Intergenic
1035791497 8:2309771-2309793 ATTCATCTGAAGAAGTAGAATGG + Intergenic
1035801308 8:2411934-2411956 ATTCATCTGAAGAAGTAGAATGG - Intergenic
1036053610 8:5226862-5226884 AGGAAAATGAAGAAGGAGGGAGG - Intergenic
1036695604 8:10972767-10972789 AGACATCTGGAGATGGATGGTGG + Intronic
1036915099 8:12796990-12797012 AGTCATCTGCAGGATGTGGGTGG + Intergenic
1037498762 8:19465402-19465424 AGTACTCTGAAGATGGATGGTGG + Intronic
1037586363 8:20279328-20279350 AGCCATCCAAGGAAGGAGGGAGG + Intronic
1037639469 8:20729728-20729750 AGGCAGCAGAAGAGGGAGGGAGG - Intergenic
1038222199 8:25621464-25621486 AATCATCTGGAGGAGGAAGGAGG + Intergenic
1039473534 8:37827694-37827716 CCTCATCTGAAGGAGGAGGCTGG + Intronic
1041278867 8:56191165-56191187 AGTCATCTGGAAAAGGCAGGAGG + Intronic
1042258659 8:66833446-66833468 AGTCTCTTGAAGAAGAAGGGAGG - Intronic
1042402836 8:68369728-68369750 AGTCATCTGGAGAAGCAGACAGG + Intronic
1044579545 8:93811130-93811152 AGACATGTGAATAAGTAGGGTGG + Intronic
1047106702 8:121739423-121739445 AGTCATGTGCAGATGGAAGGAGG + Intergenic
1047277767 8:123418597-123418619 AGAGATCTGAAAAAAGAGGGTGG + Intronic
1047772243 8:128038900-128038922 AGACATCTGGAGAGGGAGAGAGG - Intergenic
1047988875 8:130264934-130264956 AAACATCTTAAGAAAGAGGGAGG + Intronic
1048323187 8:133417866-133417888 AGGCATCTCCAGAAGGAAGGGGG - Intergenic
1049986197 9:954112-954134 AGGCATCTGGAGCAGGAGAGAGG + Intronic
1050277792 9:4018132-4018154 AGTCATCTGAAAAGGAAGGCAGG + Intronic
1050586679 9:7119814-7119836 AAACATCTGAACCAGGAGGGAGG - Intergenic
1052764446 9:32626460-32626482 AGTGATGTGAAGAATGGGGGAGG - Intergenic
1052767318 9:32654561-32654583 AGTCATCTGAATAGGAAGAGAGG + Intergenic
1053310833 9:37018422-37018444 TGTCATCTCAGGAAGGTGGGCGG - Intronic
1055181801 9:73397261-73397283 AGTCCTATGAAGAATGATGGTGG + Intergenic
1056107164 9:83358457-83358479 AGTTATGTGAAGAATGATGGTGG + Intronic
1056651003 9:88462348-88462370 AGTCACCTGAAGCAGGAATGTGG + Intronic
1057214754 9:93221504-93221526 AATCATATGTAGAAGGAGGCAGG - Intronic
1058995880 9:110298371-110298393 AGTGATTTGAAAATGGAGGGCGG - Intergenic
1059037474 9:110771629-110771651 AGTTATGTGAAGAAGTAGGTAGG + Intronic
1059196508 9:112375898-112375920 AGTTATCTGCAGAAGAAGGCAGG + Intergenic
1059958751 9:119544875-119544897 AATCATCAGATGGAGGAGGGTGG - Intergenic
1060218602 9:121752881-121752903 CCTCATCTGAAAAAGGAGGAAGG - Intronic
1062215905 9:135389771-135389793 GCTCATATGAAGAAGGAGGGGGG + Intergenic
1185592230 X:1285189-1285211 AATCATCTGAAGACTGGGGGTGG - Intronic
1189236283 X:39489661-39489683 ACTCACCTGATGAAGGAGGCAGG + Intergenic
1190428631 X:50356417-50356439 AGTCCTGTGAAGAATGATGGTGG + Intergenic
1192687962 X:73326846-73326868 AGTTATGTGAAGAAAGATGGTGG + Intergenic
1193321444 X:80126780-80126802 AGTCATTTGAAGAATGATGATGG + Intergenic
1193950615 X:87793295-87793317 AGTTATGTGAAGAATGATGGTGG + Intergenic
1193957280 X:87878178-87878200 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
1194179594 X:90695967-90695989 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1194319329 X:92424012-92424034 AGTTCTGTGAAGAATGAGGGTGG + Intronic
1195162676 X:102185724-102185746 AGTAATCTGGTGGAGGAGGGGGG + Intergenic
1195473549 X:105260060-105260082 AGTCACCTGAAGGAGGTGGGTGG + Intronic
1197782830 X:130174007-130174029 GGGAATCTAAAGAAGGAGGGAGG + Intronic
1198834856 X:140794352-140794374 AGTCATCTGAAGGAGGTGTTAGG - Intergenic
1199509149 X:148600740-148600762 AGGCATCTGGAGATGGAAGGAGG - Intronic
1200526256 Y:4278136-4278158 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1200627460 Y:5537087-5537109 AGTTCTGTGAAGAATGAGGGTGG + Intronic
1201228629 Y:11842341-11842363 AGTCTTCTGAAGAGGGCAGGAGG + Intergenic