ID: 1106663468

View in Genome Browser
Species Human (GRCh38)
Location 13:31826824-31826846
Sequence GTTTTTAAGGGTTTTGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106663468_1106663482 15 Left 1106663468 13:31826824-31826846 CCCACCCCAAAACCCTTAAAAAC No data
Right 1106663482 13:31826862-31826884 CTCATGGAGATATGGATTTGAGG No data
1106663468_1106663480 7 Left 1106663468 13:31826824-31826846 CCCACCCCAAAACCCTTAAAAAC No data
Right 1106663480 13:31826854-31826876 CTAAACTCCTCATGGAGATATGG No data
1106663468_1106663476 -1 Left 1106663468 13:31826824-31826846 CCCACCCCAAAACCCTTAAAAAC No data
Right 1106663476 13:31826846-31826868 CCCTTGCCCTAAACTCCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106663468 Original CRISPR GTTTTTAAGGGTTTTGGGGT GGG (reversed) Intergenic
No off target data available for this crispr