ID: 1106666863

View in Genome Browser
Species Human (GRCh38)
Location 13:31860433-31860455
Sequence CAGAAGAAAGAAAAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106666863_1106666867 12 Left 1106666863 13:31860433-31860455 CCATCCTCCTTTTCTTTCTTCTG No data
Right 1106666867 13:31860468-31860490 ATCTTTCATCAGATTCTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106666863 Original CRISPR CAGAAGAAAGAAAAGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr