ID: 1106670131

View in Genome Browser
Species Human (GRCh38)
Location 13:31896480-31896502
Sequence GAGCCTCCTCAGCCCCTCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106670131_1106670134 20 Left 1106670131 13:31896480-31896502 CCGTGGAGGGGCTGAGGAGGCTC No data
Right 1106670134 13:31896523-31896545 TCTGGTGAAAAGAATGTCCCTGG No data
1106670131_1106670135 26 Left 1106670131 13:31896480-31896502 CCGTGGAGGGGCTGAGGAGGCTC No data
Right 1106670135 13:31896529-31896551 GAAAAGAATGTCCCTGGCAGAGG No data
1106670131_1106670136 29 Left 1106670131 13:31896480-31896502 CCGTGGAGGGGCTGAGGAGGCTC No data
Right 1106670136 13:31896532-31896554 AAGAATGTCCCTGGCAGAGGAGG No data
1106670131_1106670133 2 Left 1106670131 13:31896480-31896502 CCGTGGAGGGGCTGAGGAGGCTC No data
Right 1106670133 13:31896505-31896527 CTCTGTGACTCTGACAGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106670131 Original CRISPR GAGCCTCCTCAGCCCCTCCA CGG (reversed) Intergenic
No off target data available for this crispr