ID: 1106674168

View in Genome Browser
Species Human (GRCh38)
Location 13:31940111-31940133
Sequence AAACTCAGCATGTATAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106674168_1106674173 26 Left 1106674168 13:31940111-31940133 CCAGTTTTATACATGCTGAGTTT No data
Right 1106674173 13:31940160-31940182 TATAGATATCTAGGACACTATGG No data
1106674168_1106674172 17 Left 1106674168 13:31940111-31940133 CCAGTTTTATACATGCTGAGTTT No data
Right 1106674172 13:31940151-31940173 GCAATTAAATATAGATATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106674168 Original CRISPR AAACTCAGCATGTATAAAAC TGG (reversed) Intergenic
No off target data available for this crispr